ID: 1055837683

View in Genome Browser
Species Human (GRCh38)
Location 9:80463739-80463761
Sequence GCTTAGATATTACACCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055837682_1055837683 -10 Left 1055837682 9:80463726-80463748 CCTTGGAAATTCAGCTTAGATAT No data
Right 1055837683 9:80463739-80463761 GCTTAGATATTACACCATCCAGG No data
1055837677_1055837683 27 Left 1055837677 9:80463689-80463711 CCCTTGCCATTCTTTCTTCACTT No data
Right 1055837683 9:80463739-80463761 GCTTAGATATTACACCATCCAGG No data
1055837680_1055837683 21 Left 1055837680 9:80463695-80463717 CCATTCTTTCTTCACTTGGTTTA No data
Right 1055837683 9:80463739-80463761 GCTTAGATATTACACCATCCAGG No data
1055837678_1055837683 26 Left 1055837678 9:80463690-80463712 CCTTGCCATTCTTTCTTCACTTG No data
Right 1055837683 9:80463739-80463761 GCTTAGATATTACACCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055837683 Original CRISPR GCTTAGATATTACACCATCC AGG Intergenic
No off target data available for this crispr