ID: 1055843913

View in Genome Browser
Species Human (GRCh38)
Location 9:80537771-80537793
Sequence CCCAAGTCTCCACAATTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055843909_1055843913 -7 Left 1055843909 9:80537755-80537777 CCCTTGACCTTGAACTCCCAAGT No data
Right 1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG No data
1055843903_1055843913 27 Left 1055843903 9:80537721-80537743 CCCCACTAGCAAGAAGGCTCTCA No data
Right 1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG No data
1055843907_1055843913 -5 Left 1055843907 9:80537753-80537775 CCCCCTTGACCTTGAACTCCCAA No data
Right 1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG No data
1055843904_1055843913 26 Left 1055843904 9:80537722-80537744 CCCACTAGCAAGAAGGCTCTCAC No data
Right 1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG No data
1055843905_1055843913 25 Left 1055843905 9:80537723-80537745 CCACTAGCAAGAAGGCTCTCACC No data
Right 1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG No data
1055843910_1055843913 -8 Left 1055843910 9:80537756-80537778 CCTTGACCTTGAACTCCCAAGTC No data
Right 1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG No data
1055843908_1055843913 -6 Left 1055843908 9:80537754-80537776 CCCCTTGACCTTGAACTCCCAAG No data
Right 1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG No data
1055843906_1055843913 4 Left 1055843906 9:80537744-80537766 CCAGATGAGCCCCCTTGACCTTG No data
Right 1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055843913 Original CRISPR CCCAAGTCTCCACAATTGTA AGG Intergenic
No off target data available for this crispr