ID: 1055846154

View in Genome Browser
Species Human (GRCh38)
Location 9:80565573-80565595
Sequence ATCCTATCCATTATAGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055846154_1055846158 13 Left 1055846154 9:80565573-80565595 CCGCCCACTATAATGGATAGGAT No data
Right 1055846158 9:80565609-80565631 AGAATGTTCGTGTTTGTTGATGG No data
1055846154_1055846159 14 Left 1055846154 9:80565573-80565595 CCGCCCACTATAATGGATAGGAT No data
Right 1055846159 9:80565610-80565632 GAATGTTCGTGTTTGTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055846154 Original CRISPR ATCCTATCCATTATAGTGGG CGG (reversed) Intergenic
No off target data available for this crispr