ID: 1055847659

View in Genome Browser
Species Human (GRCh38)
Location 9:80586801-80586823
Sequence CACTCTCAGCAACTAGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055847655_1055847659 9 Left 1055847655 9:80586769-80586791 CCTCATTTCCTTGCAAGCTGTCA No data
Right 1055847659 9:80586801-80586823 CACTCTCAGCAACTAGACACTGG No data
1055847657_1055847659 1 Left 1055847657 9:80586777-80586799 CCTTGCAAGCTGTCAGCTCGGTA No data
Right 1055847659 9:80586801-80586823 CACTCTCAGCAACTAGACACTGG No data
1055847654_1055847659 30 Left 1055847654 9:80586748-80586770 CCTCACAGTTTAGATTTAGGTCC No data
Right 1055847659 9:80586801-80586823 CACTCTCAGCAACTAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055847659 Original CRISPR CACTCTCAGCAACTAGACAC TGG Intergenic
No off target data available for this crispr