ID: 1055848035

View in Genome Browser
Species Human (GRCh38)
Location 9:80591290-80591312
Sequence GCTGCTAATGAAGCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055848035_1055848042 22 Left 1055848035 9:80591290-80591312 CCTGCTTGTGCTTCATTAGCAGC No data
Right 1055848042 9:80591335-80591357 TCTGTACTGACCCCATCTTGTGG No data
1055848035_1055848043 23 Left 1055848035 9:80591290-80591312 CCTGCTTGTGCTTCATTAGCAGC No data
Right 1055848043 9:80591336-80591358 CTGTACTGACCCCATCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055848035 Original CRISPR GCTGCTAATGAAGCACAAGC AGG (reversed) Intergenic
No off target data available for this crispr