ID: 1055848043

View in Genome Browser
Species Human (GRCh38)
Location 9:80591336-80591358
Sequence CTGTACTGACCCCATCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055848039_1055848043 -1 Left 1055848039 9:80591314-80591336 CCACGGCTTCCCTAACTACTCTC No data
Right 1055848043 9:80591336-80591358 CTGTACTGACCCCATCTTGTGGG No data
1055848035_1055848043 23 Left 1055848035 9:80591290-80591312 CCTGCTTGTGCTTCATTAGCAGC No data
Right 1055848043 9:80591336-80591358 CTGTACTGACCCCATCTTGTGGG No data
1055848034_1055848043 28 Left 1055848034 9:80591285-80591307 CCAGTCCTGCTTGTGCTTCATTA No data
Right 1055848043 9:80591336-80591358 CTGTACTGACCCCATCTTGTGGG No data
1055848037_1055848043 1 Left 1055848037 9:80591312-80591334 CCCCACGGCTTCCCTAACTACTC No data
Right 1055848043 9:80591336-80591358 CTGTACTGACCCCATCTTGTGGG No data
1055848040_1055848043 -10 Left 1055848040 9:80591323-80591345 CCCTAACTACTCTCTGTACTGAC No data
Right 1055848043 9:80591336-80591358 CTGTACTGACCCCATCTTGTGGG No data
1055848038_1055848043 0 Left 1055848038 9:80591313-80591335 CCCACGGCTTCCCTAACTACTCT No data
Right 1055848043 9:80591336-80591358 CTGTACTGACCCCATCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055848043 Original CRISPR CTGTACTGACCCCATCTTGT GGG Intergenic
No off target data available for this crispr