ID: 1055850259

View in Genome Browser
Species Human (GRCh38)
Location 9:80619351-80619373
Sequence CTGCTCCTATGTAATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055850259_1055850263 8 Left 1055850259 9:80619351-80619373 CCTACTTTATTACATAGGAGCAG No data
Right 1055850263 9:80619382-80619404 TTTTAAAATATGTCATATAGGGG No data
1055850259_1055850266 28 Left 1055850259 9:80619351-80619373 CCTACTTTATTACATAGGAGCAG No data
Right 1055850266 9:80619402-80619424 GGGGCCTCCCACCTCCCTTAGGG No data
1055850259_1055850262 7 Left 1055850259 9:80619351-80619373 CCTACTTTATTACATAGGAGCAG No data
Right 1055850262 9:80619381-80619403 CTTTTAAAATATGTCATATAGGG No data
1055850259_1055850265 27 Left 1055850259 9:80619351-80619373 CCTACTTTATTACATAGGAGCAG No data
Right 1055850265 9:80619401-80619423 GGGGGCCTCCCACCTCCCTTAGG No data
1055850259_1055850261 6 Left 1055850259 9:80619351-80619373 CCTACTTTATTACATAGGAGCAG No data
Right 1055850261 9:80619380-80619402 TCTTTTAAAATATGTCATATAGG No data
1055850259_1055850264 9 Left 1055850259 9:80619351-80619373 CCTACTTTATTACATAGGAGCAG No data
Right 1055850264 9:80619383-80619405 TTTAAAATATGTCATATAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055850259 Original CRISPR CTGCTCCTATGTAATAAAGT AGG (reversed) Intergenic
No off target data available for this crispr