ID: 1055852422

View in Genome Browser
Species Human (GRCh38)
Location 9:80648361-80648383
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055852421_1055852422 -6 Left 1055852421 9:80648344-80648366 CCAGTAACTCAACTGCACATTGT No data
Right 1055852422 9:80648361-80648383 CATTGTAACCAGAGTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055852422 Original CRISPR CATTGTAACCAGAGTTTTGT AGG Intergenic
No off target data available for this crispr