ID: 1055854521

View in Genome Browser
Species Human (GRCh38)
Location 9:80669912-80669934
Sequence CTACTGCAGGACCAAGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055854521_1055854525 -7 Left 1055854521 9:80669912-80669934 CCCACACCTTGGTCCTGCAGTAG No data
Right 1055854525 9:80669928-80669950 GCAGTAGCCCACAGAACTGATGG No data
1055854521_1055854529 23 Left 1055854521 9:80669912-80669934 CCCACACCTTGGTCCTGCAGTAG No data
Right 1055854529 9:80669958-80669980 TGTCCTCACAAAGTGTGAAAGGG No data
1055854521_1055854528 22 Left 1055854521 9:80669912-80669934 CCCACACCTTGGTCCTGCAGTAG No data
Right 1055854528 9:80669957-80669979 TTGTCCTCACAAAGTGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055854521 Original CRISPR CTACTGCAGGACCAAGGTGT GGG (reversed) Intergenic
No off target data available for this crispr