ID: 1055856803

View in Genome Browser
Species Human (GRCh38)
Location 9:80698169-80698191
Sequence GAGAATTCCAGCCAGCACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055856803_1055856806 14 Left 1055856803 9:80698169-80698191 CCTTAGTGCTGGCTGGAATTCTC No data
Right 1055856806 9:80698206-80698228 CTCCCTACCAGATACTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055856803 Original CRISPR GAGAATTCCAGCCAGCACTA AGG (reversed) Intergenic
No off target data available for this crispr