ID: 1055862191

View in Genome Browser
Species Human (GRCh38)
Location 9:80765028-80765050
Sequence GTGTAAAAGCAGAATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055862191_1055862194 21 Left 1055862191 9:80765028-80765050 CCTTGCTCATTCTGCTTTTACAC No data
Right 1055862194 9:80765072-80765094 TTCATGGATTGCATATCTTTTGG No data
1055862191_1055862195 26 Left 1055862191 9:80765028-80765050 CCTTGCTCATTCTGCTTTTACAC No data
Right 1055862195 9:80765077-80765099 GGATTGCATATCTTTTGGTATGG No data
1055862191_1055862192 5 Left 1055862191 9:80765028-80765050 CCTTGCTCATTCTGCTTTTACAC No data
Right 1055862192 9:80765056-80765078 CTTTGCCTATTCTCTCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055862191 Original CRISPR GTGTAAAAGCAGAATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr