ID: 1055862690

View in Genome Browser
Species Human (GRCh38)
Location 9:80772042-80772064
Sequence TCATTAACACACATGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055862690_1055862692 23 Left 1055862690 9:80772042-80772064 CCTTGGTCCATGTGTGTTAATGA No data
Right 1055862692 9:80772088-80772110 AGTTTCTATTTCCGTTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055862690 Original CRISPR TCATTAACACACATGGACCA AGG (reversed) Intergenic
No off target data available for this crispr