ID: 1055864277

View in Genome Browser
Species Human (GRCh38)
Location 9:80794099-80794121
Sequence CTAGTACTCCTCCTATATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055864277_1055864279 23 Left 1055864277 9:80794099-80794121 CCTATATATAGGAGGAGTACTAG No data
Right 1055864279 9:80794145-80794167 CTAGATACTAGATACTAGACAGG No data
1055864277_1055864278 -4 Left 1055864277 9:80794099-80794121 CCTATATATAGGAGGAGTACTAG No data
Right 1055864278 9:80794118-80794140 CTAGATACTAGATACTGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055864277 Original CRISPR CTAGTACTCCTCCTATATAT AGG (reversed) Intergenic
No off target data available for this crispr