ID: 1055871152

View in Genome Browser
Species Human (GRCh38)
Location 9:80881444-80881466
Sequence CAGCATATGCAGAAATTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055871152_1055871154 27 Left 1055871152 9:80881444-80881466 CCGCACAATTTCTGCATATGCTG No data
Right 1055871154 9:80881494-80881516 ATAAACCAGCGTGAGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055871152 Original CRISPR CAGCATATGCAGAAATTGTG CGG (reversed) Intergenic
No off target data available for this crispr