ID: 1055872002

View in Genome Browser
Species Human (GRCh38)
Location 9:80891840-80891862
Sequence CCTACTATGAACAAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055871998_1055872002 -7 Left 1055871998 9:80891824-80891846 CCTCATTCTTGTAAGCCCTACTA No data
Right 1055872002 9:80891840-80891862 CCTACTATGAACAAGGAGCATGG No data
1055871996_1055872002 5 Left 1055871996 9:80891812-80891834 CCCAAACTGTGGCCTCATTCTTG No data
Right 1055872002 9:80891840-80891862 CCTACTATGAACAAGGAGCATGG No data
1055871993_1055872002 21 Left 1055871993 9:80891796-80891818 CCCAAATTGTCAATTTCCCAAAC No data
Right 1055872002 9:80891840-80891862 CCTACTATGAACAAGGAGCATGG No data
1055871994_1055872002 20 Left 1055871994 9:80891797-80891819 CCAAATTGTCAATTTCCCAAACT No data
Right 1055872002 9:80891840-80891862 CCTACTATGAACAAGGAGCATGG No data
1055871992_1055872002 22 Left 1055871992 9:80891795-80891817 CCCCAAATTGTCAATTTCCCAAA No data
Right 1055872002 9:80891840-80891862 CCTACTATGAACAAGGAGCATGG No data
1055871997_1055872002 4 Left 1055871997 9:80891813-80891835 CCAAACTGTGGCCTCATTCTTGT No data
Right 1055872002 9:80891840-80891862 CCTACTATGAACAAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055872002 Original CRISPR CCTACTATGAACAAGGAGCA TGG Intergenic
No off target data available for this crispr