ID: 1055872062

View in Genome Browser
Species Human (GRCh38)
Location 9:80892754-80892776
Sequence CTAGTTTATAACCCTTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055872060_1055872062 16 Left 1055872060 9:80892715-80892737 CCTTTCCTTACTTTAAGAAGTTT No data
Right 1055872062 9:80892754-80892776 CTAGTTTATAACCCTTATGAAGG No data
1055872059_1055872062 17 Left 1055872059 9:80892714-80892736 CCCTTTCCTTACTTTAAGAAGTT No data
Right 1055872062 9:80892754-80892776 CTAGTTTATAACCCTTATGAAGG No data
1055872061_1055872062 11 Left 1055872061 9:80892720-80892742 CCTTACTTTAAGAAGTTTATAAG No data
Right 1055872062 9:80892754-80892776 CTAGTTTATAACCCTTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055872062 Original CRISPR CTAGTTTATAACCCTTATGA AGG Intergenic
No off target data available for this crispr