ID: 1055880263

View in Genome Browser
Species Human (GRCh38)
Location 9:80992804-80992826
Sequence TTGAATATATAGATGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055880260_1055880263 -10 Left 1055880260 9:80992791-80992813 CCTGGAGATGGCCTTGAATATAT No data
Right 1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG No data
1055880257_1055880263 12 Left 1055880257 9:80992769-80992791 CCACACAATAACTTGGTATTTTC No data
Right 1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055880263 Original CRISPR TTGAATATATAGATGAAGCT GGG Intergenic
No off target data available for this crispr