ID: 1055880767

View in Genome Browser
Species Human (GRCh38)
Location 9:81000710-81000732
Sequence GAGCACAAATAAGTGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055880767_1055880774 22 Left 1055880767 9:81000710-81000732 CCTTGTACCACTTATTTGTGCTC No data
Right 1055880774 9:81000755-81000777 CCTCCACTTCCATCTTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055880767 Original CRISPR GAGCACAAATAAGTGGTACA AGG (reversed) Intergenic
No off target data available for this crispr