ID: 1055884143

View in Genome Browser
Species Human (GRCh38)
Location 9:81039407-81039429
Sequence ACTTATATGTGGAGTCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055884143_1055884148 10 Left 1055884143 9:81039407-81039429 CCCCCTAGACTCCACATATAAGT No data
Right 1055884148 9:81039440-81039462 AATATTTTTCTTTCTGTGTCTGG 0: 50
1: 258
2: 1113
3: 3267
4: 6364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055884143 Original CRISPR ACTTATATGTGGAGTCTAGG GGG (reversed) Intergenic
No off target data available for this crispr