ID: 1055891517

View in Genome Browser
Species Human (GRCh38)
Location 9:81129154-81129176
Sequence AGTATCTACCCTCTGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055891517_1055891518 28 Left 1055891517 9:81129154-81129176 CCTGAAGACAGAGGGTAGATACT No data
Right 1055891518 9:81129205-81129227 TAACATTGTCAGAACTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055891517 Original CRISPR AGTATCTACCCTCTGTCTTC AGG (reversed) Intergenic
No off target data available for this crispr