ID: 1055891798

View in Genome Browser
Species Human (GRCh38)
Location 9:81131535-81131557
Sequence CCCTATGTTCAGATAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055891790_1055891798 -1 Left 1055891790 9:81131513-81131535 CCAAAGTGCCATCTTGCCCCCTC No data
Right 1055891798 9:81131535-81131557 CCCTATGTTCAGATAAGGAATGG No data
1055891791_1055891798 -9 Left 1055891791 9:81131521-81131543 CCATCTTGCCCCCTCCCTATGTT No data
Right 1055891798 9:81131535-81131557 CCCTATGTTCAGATAAGGAATGG No data
1055891789_1055891798 25 Left 1055891789 9:81131487-81131509 CCAAGTGTAATTTGATAGCAGAA No data
Right 1055891798 9:81131535-81131557 CCCTATGTTCAGATAAGGAATGG No data
1055891788_1055891798 26 Left 1055891788 9:81131486-81131508 CCCAAGTGTAATTTGATAGCAGA No data
Right 1055891798 9:81131535-81131557 CCCTATGTTCAGATAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055891798 Original CRISPR CCCTATGTTCAGATAAGGAA TGG Intergenic
No off target data available for this crispr