ID: 1055896960

View in Genome Browser
Species Human (GRCh38)
Location 9:81188233-81188255
Sequence CAGTGAAATGAAAAGAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055896960_1055896965 12 Left 1055896960 9:81188233-81188255 CCCGCTTTCTTTTCATTTCACTG No data
Right 1055896965 9:81188268-81188290 TCAGTAGGGTCCATTTAATCGGG No data
1055896960_1055896963 -2 Left 1055896960 9:81188233-81188255 CCCGCTTTCTTTTCATTTCACTG No data
Right 1055896963 9:81188254-81188276 TGTTTTGTTTGCTCTCAGTAGGG No data
1055896960_1055896964 11 Left 1055896960 9:81188233-81188255 CCCGCTTTCTTTTCATTTCACTG No data
Right 1055896964 9:81188267-81188289 CTCAGTAGGGTCCATTTAATCGG No data
1055896960_1055896962 -3 Left 1055896960 9:81188233-81188255 CCCGCTTTCTTTTCATTTCACTG No data
Right 1055896962 9:81188253-81188275 CTGTTTTGTTTGCTCTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055896960 Original CRISPR CAGTGAAATGAAAAGAAAGC GGG (reversed) Intergenic
No off target data available for this crispr