ID: 1055903892

View in Genome Browser
Species Human (GRCh38)
Location 9:81270873-81270895
Sequence AGGAAGAGAAGACTAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055903892_1055903900 23 Left 1055903892 9:81270873-81270895 CCAGGCCCTAGTCTTCTCTTCCT No data
Right 1055903900 9:81270919-81270941 CCCCATGAGGACATCTGTACAGG No data
1055903892_1055903903 27 Left 1055903892 9:81270873-81270895 CCAGGCCCTAGTCTTCTCTTCCT No data
Right 1055903903 9:81270923-81270945 ATGAGGACATCTGTACAGGCTGG No data
1055903892_1055903906 30 Left 1055903892 9:81270873-81270895 CCAGGCCCTAGTCTTCTCTTCCT No data
Right 1055903906 9:81270926-81270948 AGGACATCTGTACAGGCTGGGGG No data
1055903892_1055903904 28 Left 1055903892 9:81270873-81270895 CCAGGCCCTAGTCTTCTCTTCCT No data
Right 1055903904 9:81270924-81270946 TGAGGACATCTGTACAGGCTGGG No data
1055903892_1055903896 -4 Left 1055903892 9:81270873-81270895 CCAGGCCCTAGTCTTCTCTTCCT No data
Right 1055903896 9:81270892-81270914 TCCTCTGTCAACTGATCACAGGG No data
1055903892_1055903905 29 Left 1055903892 9:81270873-81270895 CCAGGCCCTAGTCTTCTCTTCCT No data
Right 1055903905 9:81270925-81270947 GAGGACATCTGTACAGGCTGGGG No data
1055903892_1055903895 -5 Left 1055903892 9:81270873-81270895 CCAGGCCCTAGTCTTCTCTTCCT No data
Right 1055903895 9:81270891-81270913 TTCCTCTGTCAACTGATCACAGG No data
1055903892_1055903898 10 Left 1055903892 9:81270873-81270895 CCAGGCCCTAGTCTTCTCTTCCT No data
Right 1055903898 9:81270906-81270928 ATCACAGGGAACTCCCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055903892 Original CRISPR AGGAAGAGAAGACTAGGGCC TGG (reversed) Intergenic