ID: 1055903894

View in Genome Browser
Species Human (GRCh38)
Location 9:81270879-81270901
Sequence TGACAGAGGAAGAGAAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055903894_1055903903 21 Left 1055903894 9:81270879-81270901 CCTAGTCTTCTCTTCCTCTGTCA No data
Right 1055903903 9:81270923-81270945 ATGAGGACATCTGTACAGGCTGG No data
1055903894_1055903896 -10 Left 1055903894 9:81270879-81270901 CCTAGTCTTCTCTTCCTCTGTCA No data
Right 1055903896 9:81270892-81270914 TCCTCTGTCAACTGATCACAGGG No data
1055903894_1055903898 4 Left 1055903894 9:81270879-81270901 CCTAGTCTTCTCTTCCTCTGTCA No data
Right 1055903898 9:81270906-81270928 ATCACAGGGAACTCCCCATGAGG No data
1055903894_1055903904 22 Left 1055903894 9:81270879-81270901 CCTAGTCTTCTCTTCCTCTGTCA No data
Right 1055903904 9:81270924-81270946 TGAGGACATCTGTACAGGCTGGG No data
1055903894_1055903906 24 Left 1055903894 9:81270879-81270901 CCTAGTCTTCTCTTCCTCTGTCA No data
Right 1055903906 9:81270926-81270948 AGGACATCTGTACAGGCTGGGGG No data
1055903894_1055903900 17 Left 1055903894 9:81270879-81270901 CCTAGTCTTCTCTTCCTCTGTCA No data
Right 1055903900 9:81270919-81270941 CCCCATGAGGACATCTGTACAGG No data
1055903894_1055903905 23 Left 1055903894 9:81270879-81270901 CCTAGTCTTCTCTTCCTCTGTCA No data
Right 1055903905 9:81270925-81270947 GAGGACATCTGTACAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055903894 Original CRISPR TGACAGAGGAAGAGAAGACT AGG (reversed) Intergenic