ID: 1055903897

View in Genome Browser
Species Human (GRCh38)
Location 9:81270893-81270915
Sequence TCCCTGTGATCAGTTGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055903897_1055903905 9 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903905 9:81270925-81270947 GAGGACATCTGTACAGGCTGGGG No data
1055903897_1055903906 10 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903906 9:81270926-81270948 AGGACATCTGTACAGGCTGGGGG No data
1055903897_1055903903 7 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903903 9:81270923-81270945 ATGAGGACATCTGTACAGGCTGG No data
1055903897_1055903900 3 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903900 9:81270919-81270941 CCCCATGAGGACATCTGTACAGG No data
1055903897_1055903911 30 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903911 9:81270946-81270968 GGGAGAGAAGGTAGGGTGGCAGG No data
1055903897_1055903898 -10 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903898 9:81270906-81270928 ATCACAGGGAACTCCCCATGAGG No data
1055903897_1055903909 23 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903909 9:81270939-81270961 AGGCTGGGGGAGAGAAGGTAGGG No data
1055903897_1055903910 26 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903910 9:81270942-81270964 CTGGGGGAGAGAAGGTAGGGTGG No data
1055903897_1055903908 22 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903908 9:81270938-81270960 CAGGCTGGGGGAGAGAAGGTAGG No data
1055903897_1055903904 8 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903904 9:81270924-81270946 TGAGGACATCTGTACAGGCTGGG No data
1055903897_1055903907 18 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903907 9:81270934-81270956 TGTACAGGCTGGGGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055903897 Original CRISPR TCCCTGTGATCAGTTGACAG AGG (reversed) Intergenic