ID: 1055903900

View in Genome Browser
Species Human (GRCh38)
Location 9:81270919-81270941
Sequence CCCCATGAGGACATCTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055903897_1055903900 3 Left 1055903897 9:81270893-81270915 CCTCTGTCAACTGATCACAGGGA No data
Right 1055903900 9:81270919-81270941 CCCCATGAGGACATCTGTACAGG No data
1055903892_1055903900 23 Left 1055903892 9:81270873-81270895 CCAGGCCCTAGTCTTCTCTTCCT 0: 141
1: 181
2: 172
3: 150
4: 600
Right 1055903900 9:81270919-81270941 CCCCATGAGGACATCTGTACAGG No data
1055903893_1055903900 18 Left 1055903893 9:81270878-81270900 CCCTAGTCTTCTCTTCCTCTGTC 0: 171
1: 185
2: 131
3: 179
4: 791
Right 1055903900 9:81270919-81270941 CCCCATGAGGACATCTGTACAGG No data
1055903894_1055903900 17 Left 1055903894 9:81270879-81270901 CCTAGTCTTCTCTTCCTCTGTCA 0: 176
1: 213
2: 118
3: 165
4: 625
Right 1055903900 9:81270919-81270941 CCCCATGAGGACATCTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055903900 Original CRISPR CCCCATGAGGACATCTGTAC AGG Intergenic
No off target data available for this crispr