ID: 1055903940

View in Genome Browser
Species Human (GRCh38)
Location 9:81271196-81271218
Sequence GATACCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055903940_1055903944 15 Left 1055903940 9:81271196-81271218 CCAGTAACAGGCCAAGAGGTATC No data
Right 1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
1055903940_1055903945 16 Left 1055903940 9:81271196-81271218 CCAGTAACAGGCCAAGAGGTATC No data
Right 1055903945 9:81271235-81271257 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
1055903940_1055903943 11 Left 1055903940 9:81271196-81271218 CCAGTAACAGGCCAAGAGGTATC No data
Right 1055903943 9:81271230-81271252 CAGTAGTTATCTGCAGAAGATGG 0: 7
1: 193
2: 201
3: 113
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055903940 Original CRISPR GATACCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr