ID: 1055904513

View in Genome Browser
Species Human (GRCh38)
Location 9:81277240-81277262
Sequence AGGTGTTCAAGCTACCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055904509_1055904513 -1 Left 1055904509 9:81277218-81277240 CCTTACGTGCTCTGAAAGACCTA No data
Right 1055904513 9:81277240-81277262 AGGTGTTCAAGCTACCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055904513 Original CRISPR AGGTGTTCAAGCTACCAACA GGG Intergenic
No off target data available for this crispr