ID: 1055913842

View in Genome Browser
Species Human (GRCh38)
Location 9:81380090-81380112
Sequence GTCACTGCTCAGAGAGCGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055913838_1055913842 15 Left 1055913838 9:81380052-81380074 CCCAAAACAGCAGTTGTCCAAGT No data
Right 1055913842 9:81380090-81380112 GTCACTGCTCAGAGAGCGAATGG No data
1055913841_1055913842 -2 Left 1055913841 9:81380069-81380091 CCAAGTATATGCGGCAGATGTGT No data
Right 1055913842 9:81380090-81380112 GTCACTGCTCAGAGAGCGAATGG No data
1055913839_1055913842 14 Left 1055913839 9:81380053-81380075 CCAAAACAGCAGTTGTCCAAGTA No data
Right 1055913842 9:81380090-81380112 GTCACTGCTCAGAGAGCGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055913842 Original CRISPR GTCACTGCTCAGAGAGCGAA TGG Intergenic
No off target data available for this crispr