ID: 1055914760

View in Genome Browser
Species Human (GRCh38)
Location 9:81389674-81389696
Sequence CTGGGTCCTTGCCATGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055914760_1055914764 27 Left 1055914760 9:81389674-81389696 CCTCCAGCATGGCAAGGACCCAG No data
Right 1055914764 9:81389724-81389746 GAAAACATAACTAGACAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055914760 Original CRISPR CTGGGTCCTTGCCATGCTGG AGG (reversed) Intergenic
No off target data available for this crispr