ID: 1055914948

View in Genome Browser
Species Human (GRCh38)
Location 9:81391483-81391505
Sequence AAACATACAAAGCTACAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055914944_1055914948 24 Left 1055914944 9:81391436-81391458 CCAAAGGCTGTTAGATACATAGA No data
Right 1055914948 9:81391483-81391505 AAACATACAAAGCTACAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055914948 Original CRISPR AAACATACAAAGCTACAGCC CGG Intergenic
No off target data available for this crispr