ID: 1055915576

View in Genome Browser
Species Human (GRCh38)
Location 9:81396891-81396913
Sequence GATTTTAATTCCCATCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055915576_1055915577 -10 Left 1055915576 9:81396891-81396913 CCTGGAGGATGGGAATTAAAATC No data
Right 1055915577 9:81396904-81396926 AATTAAAATCCTCCTTCTATTGG No data
1055915576_1055915579 1 Left 1055915576 9:81396891-81396913 CCTGGAGGATGGGAATTAAAATC No data
Right 1055915579 9:81396915-81396937 TCCTTCTATTGGCTTCACCCAGG No data
1055915576_1055915581 2 Left 1055915576 9:81396891-81396913 CCTGGAGGATGGGAATTAAAATC No data
Right 1055915581 9:81396916-81396938 CCTTCTATTGGCTTCACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055915576 Original CRISPR GATTTTAATTCCCATCCTCC AGG (reversed) Intergenic
No off target data available for this crispr