ID: 1055928835

View in Genome Browser
Species Human (GRCh38)
Location 9:81539013-81539035
Sequence CTGAATCAGCAGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055928829_1055928835 -3 Left 1055928829 9:81538993-81539015 CCCATGGTGCTGGAGAATACCTG No data
Right 1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG No data
1055928830_1055928835 -4 Left 1055928830 9:81538994-81539016 CCATGGTGCTGGAGAATACCTGA No data
Right 1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG No data
1055928826_1055928835 9 Left 1055928826 9:81538981-81539003 CCAGAGACGAGCCCCATGGTGCT No data
Right 1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG No data
1055928828_1055928835 -2 Left 1055928828 9:81538992-81539014 CCCCATGGTGCTGGAGAATACCT No data
Right 1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055928835 Original CRISPR CTGAATCAGCAGAAGGTGGG AGG Intergenic
No off target data available for this crispr