ID: 1055937213

View in Genome Browser
Species Human (GRCh38)
Location 9:81614361-81614383
Sequence CTTTGGTTATGTAGGCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055937213_1055937222 19 Left 1055937213 9:81614361-81614383 CCCACTTGCCTACATAACCAAAG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1055937222 9:81614403-81614425 CAGAGACTGAACACCAGCAAGGG No data
1055937213_1055937223 20 Left 1055937213 9:81614361-81614383 CCCACTTGCCTACATAACCAAAG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1055937223 9:81614404-81614426 AGAGACTGAACACCAGCAAGGGG No data
1055937213_1055937224 28 Left 1055937213 9:81614361-81614383 CCCACTTGCCTACATAACCAAAG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1055937224 9:81614412-81614434 AACACCAGCAAGGGGCCTTTCGG No data
1055937213_1055937221 18 Left 1055937213 9:81614361-81614383 CCCACTTGCCTACATAACCAAAG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1055937221 9:81614402-81614424 TCAGAGACTGAACACCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055937213 Original CRISPR CTTTGGTTATGTAGGCAAGT GGG (reversed) Intronic
902109036 1:14062474-14062496 CTTTGTTTATTCAGGCAAATGGG + Intergenic
910684830 1:89905628-89905650 CTTTGGGTCTGCAGCCAAGTAGG + Intronic
912140917 1:106725961-106725983 CTTTGGTTATCTGGGCTTGTGGG - Intergenic
913114682 1:115685183-115685205 CCTTGGGTATGTTGGCAGGTTGG + Intronic
915155867 1:153875554-153875576 CTCTGCTTTTGTAAGCAAGTGGG + Intronic
915382743 1:155457500-155457522 ATTTACTTAAGTAGGCAAGTGGG - Intronic
923522243 1:234744334-234744356 GTTTGGTTTTGTAGGGATGTGGG + Intergenic
1065673578 10:28149464-28149486 TTTTGGTTATGAAGGTAATTTGG + Intronic
1066663702 10:37761275-37761297 CTTAGGTCATGAAGGCAGGTTGG + Intergenic
1067746144 10:48938062-48938084 ATTTGCTTATGTGGGCAAGCTGG - Intronic
1070178529 10:73993439-73993461 GTTTGGTTAGGCAGGCAAGAGGG - Intergenic
1072250134 10:93575225-93575247 TTTTGTTTCTGTAGTCAAGTGGG + Intronic
1078288069 11:9978180-9978202 CTTAGGTTATGCAGGAAATTGGG - Intronic
1079422897 11:20311075-20311097 CTTTGGTAATGAAGTCATGTGGG - Intergenic
1080244648 11:30166013-30166035 CTGTGGTTAAATTGGCAAGTAGG + Intergenic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1085272206 11:75277085-75277107 CTTTGGTTATGGAAGGAAATGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1087043307 11:93822410-93822432 CTTCCGTTATGTGGGCATGTTGG - Intronic
1093209679 12:16293133-16293155 CATTGCTTATGTGGGAAAGTAGG + Intergenic
1094163072 12:27412271-27412293 CTTAGGTAATGTATGAAAGTAGG + Intronic
1094629992 12:32164592-32164614 TATTTGTTATGGAGGCAAGTAGG + Intronic
1106061854 13:26300896-26300918 GTTTGGTACTGTAGGAAAGTGGG + Intronic
1107517354 13:41143758-41143780 CTTTGGGTTTATAGTCAAGTTGG - Intergenic
1108044262 13:46368033-46368055 CAGTGGCTATGAAGGCAAGTTGG - Exonic
1116015285 14:39399472-39399494 CTGTGGTTACATATGCAAGTAGG - Exonic
1116169100 14:41375671-41375693 CTTTGGTTATATAGCGAATTTGG + Intergenic
1116687212 14:48055368-48055390 CATTGATTATGCAGCCAAGTGGG - Intergenic
1117151026 14:52888222-52888244 CTTTCGTTTGGTAGGAAAGTGGG - Intronic
1121735265 14:96213915-96213937 CTTTGCTTATGTAGGGAGGCAGG - Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1124001454 15:25763979-25764001 CCTTGGTTTTGCATGCAAGTGGG - Intronic
1125344257 15:38702900-38702922 GGGTGGTTGTGTAGGCAAGTTGG - Intergenic
1128728283 15:70003995-70004017 CTTTGGTTATGTATGCAGAAAGG - Intergenic
1129257584 15:74342831-74342853 CTTTGGAAATGGAGGCAAGGAGG + Intronic
1130800387 15:87256636-87256658 TTTTGGTTCTGTAGACAACTGGG - Intergenic
1131647992 15:94366768-94366790 CTCTGTTTATGTATGCAGGTGGG - Intronic
1131792822 15:95983519-95983541 CTTTGGATGTGGAGGCAAATGGG + Intergenic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1135580336 16:23620370-23620392 CTTTGGTTCTCTAAGCCAGTGGG + Intronic
1137311209 16:47260891-47260913 CTCTGATTTTGTAGGCTAGTTGG + Intronic
1145398347 17:22512836-22512858 CTGTGGTCAGGCAGGCAAGTGGG + Intergenic
1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG + Intergenic
1148408270 17:47440056-47440078 CTGTAGTTTTGTAGGCAATTAGG + Intronic
1149267015 17:54938078-54938100 ACTTGTTTATGTAGGCCAGTGGG + Intronic
1151346057 17:73502125-73502147 CTTGGGTTCTGTAGCCAAATGGG - Intronic
1153484327 18:5581463-5581485 TTTTGTTTATGTAAGTAAGTAGG + Intronic
1153736868 18:8080165-8080187 CTTTTTTTTTGTAGGCAATTAGG + Intronic
1156301283 18:35838534-35838556 CATTGGTTATGTTGACAATTAGG - Intergenic
1159470358 18:68846472-68846494 CTTTGGATATGTAAGCATGTGGG + Intronic
1167305320 19:48704996-48705018 CCCTGGTTAAGAAGGCAAGTGGG + Exonic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
929652667 2:43696742-43696764 CTTTGGTTATTTCGGCAACCAGG + Intronic
930213871 2:48672703-48672725 CTGTGATTATGTAGTCAAATGGG + Intronic
931025208 2:58105560-58105582 CTTTGGTCATGTATGCATCTGGG - Intronic
931746838 2:65298378-65298400 CTTTGGTGATCTAGGCATGAAGG - Intergenic
933162480 2:79040997-79041019 TTTTAGTTATGTATGCATGTAGG + Intergenic
936690032 2:114875639-114875661 CTTTGGTTATCTAAACAAGCAGG + Intronic
937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG + Intergenic
939136326 2:138298754-138298776 TTTTGGCTTTGTAGCCAAGTTGG + Intergenic
940662440 2:156563722-156563744 CGTTGGAGATGTAGGCAAGGTGG + Intronic
944943268 2:204653223-204653245 CGTTTGTTATGTAGGTAAATTGG - Intronic
945872083 2:215238112-215238134 CTTTGTTTATGTACCCAAATTGG - Intergenic
947558804 2:231126511-231126533 CTGTGCTTATGAAGGCAGGTAGG + Intronic
1172993468 20:39052586-39052608 CTTTGTTTCTTGAGGCAAGTGGG + Intergenic
1175626959 20:60496845-60496867 ATTTGGTTATCTTGGGAAGTGGG - Intergenic
1178464671 21:32836191-32836213 CTTTGGCTCTGTAGGAAAGTTGG - Intergenic
949521009 3:4853991-4854013 TTTTGTTTGTTTAGGCAAGTGGG - Intronic
949845665 3:8367799-8367821 CCTTGGTCATCTAGGCAGGTTGG + Intergenic
955256244 3:57334833-57334855 CTTTTGTCCTGTAGCCAAGTTGG + Intronic
957262872 3:77922947-77922969 CTTTGGTTAGGGAAGGAAGTGGG - Intergenic
957691370 3:83575223-83575245 ATTTGGTTATCTAACCAAGTTGG - Intergenic
961453316 3:127012337-127012359 CCTGGGTCATGTAGGCAAGTGGG + Intronic
963218463 3:142778000-142778022 CTTTGGTTAGGTTGAAAAGTGGG - Intronic
963812632 3:149793980-149794002 TTTTGTTTATGTAAGCAAGATGG + Intronic
964675513 3:159275271-159275293 CTTTGGTTTAATAGGTAAGTAGG + Intronic
966153096 3:176887144-176887166 CTTTGGTTACCTATGCTAGTGGG - Intergenic
977114020 4:92998080-92998102 CTATGGTTATGTAGACATTTGGG + Intronic
983806195 4:171996068-171996090 TTCTGTTTATGTAAGCAAGTGGG - Intronic
987832947 5:23121322-23121344 CTTTGAATACTTAGGCAAGTGGG - Intergenic
990525689 5:56624661-56624683 ATTGGGTTATGTTGGCAAGTAGG - Intergenic
992096922 5:73371420-73371442 TTTTGGCTCTGTAGGCAACTAGG + Intergenic
995992351 5:118256154-118256176 CTTTAGTTATAATGGCAAGTAGG - Intergenic
997520792 5:134524017-134524039 CTTTGGCTTTGAAGGCACGTGGG - Intergenic
1000372922 5:160554516-160554538 CTTTAGTGATGTAGGGAAGGAGG + Intergenic
1004739827 6:18448018-18448040 CTTTGGTGATCTTGACAAGTGGG + Intronic
1017308210 6:152945353-152945375 CTTTGGAAATGTAGTCAAATTGG - Intergenic
1019763306 7:2830390-2830412 TTTTGGGTTTGTAGCCAAGTAGG + Intronic
1020263894 7:6547644-6547666 CTTTGGTGATGTAGGGAAGCTGG + Intronic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1029195644 7:98803533-98803555 GTTTGGCAATGTAGGCAAGAAGG - Intergenic
1031657126 7:124370786-124370808 CTTTGCTTATGTATCCAACTGGG + Intergenic
1036114528 8:5944486-5944508 CTTTGATTATGAAGTAAAGTAGG - Intergenic
1038251157 8:25906309-25906331 CTTTGGTCATGGAGGCACTTTGG + Intronic
1042428031 8:68672156-68672178 GTCTGGTTATGGAGGCAAGGGGG + Intronic
1044185732 8:89249391-89249413 CTTTGGGTATGTATGCAATATGG + Intergenic
1046650904 8:116835547-116835569 CTTTGGCTATTTAGGCTATTTGG + Intronic
1047784603 8:128141801-128141823 GTTTGGTGATGGAGGCAAGAGGG + Intergenic
1054755140 9:68950200-68950222 CCTTGGTTCTGTAGTCAAGCAGG + Intronic
1055937213 9:81614361-81614383 CTTTGGTTATGTAGGCAAGTGGG - Intronic
1058748981 9:108020290-108020312 CCTTGGTTATGCAGACCAGTGGG - Intergenic
1188122196 X:26321148-26321170 CTTGGGATATGTAGCCAAGAAGG + Intergenic
1189720696 X:43913315-43913337 ATTTGATTCTGCAGGCAAGTTGG + Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1193436780 X:81483296-81483318 CTTTGTTTTTGTATGCATGTTGG - Intergenic
1194467383 X:94250519-94250541 ATTTGATAATGTAGGCAAGAGGG - Intergenic
1196027981 X:111062737-111062759 CTTAGGTTATGAAGCCAATTAGG + Intronic
1196568688 X:117239837-117239859 AATTGGCTATGTAGGCAAGGGGG + Intergenic
1196715090 X:118803139-118803161 CTTTGCTAATGTAGCCAAGGAGG + Intergenic
1199137621 X:144271753-144271775 TTTTGATTATGAAGGAAAGTAGG + Intergenic