ID: 1055938737

View in Genome Browser
Species Human (GRCh38)
Location 9:81628270-81628292
Sequence CACCATTTATAGATGGGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055938722_1055938737 25 Left 1055938722 9:81628222-81628244 CCCACCTGAGGCCTCCTAACCCC 0: 1
1: 0
2: 1
3: 15
4: 244
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938731_1055938737 3 Left 1055938731 9:81628244-81628266 CCTCCCTGTGAGGCAACCACTAC 0: 1
1: 0
2: 1
3: 18
4: 126
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938728_1055938737 6 Left 1055938728 9:81628241-81628263 CCCCCTCCCTGTGAGGCAACCAC 0: 1
1: 0
2: 1
3: 33
4: 236
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938725_1055938737 14 Left 1055938725 9:81628233-81628255 CCTCCTAACCCCCTCCCTGTGAG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938723_1055938737 24 Left 1055938723 9:81628223-81628245 CCACCTGAGGCCTCCTAACCCCC 0: 1
1: 0
2: 4
3: 31
4: 312
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938733_1055938737 -1 Left 1055938733 9:81628248-81628270 CCTGTGAGGCAACCACTACTATC 0: 1
1: 0
2: 2
3: 10
4: 179
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938721_1055938737 28 Left 1055938721 9:81628219-81628241 CCTCCCACCTGAGGCCTCCTAAC 0: 1
1: 0
2: 4
3: 51
4: 612
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938732_1055938737 0 Left 1055938732 9:81628247-81628269 CCCTGTGAGGCAACCACTACTAT 0: 1
1: 0
2: 1
3: 23
4: 227
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938724_1055938737 21 Left 1055938724 9:81628226-81628248 CCTGAGGCCTCCTAACCCCCTCC 0: 1
1: 0
2: 0
3: 45
4: 345
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938730_1055938737 4 Left 1055938730 9:81628243-81628265 CCCTCCCTGTGAGGCAACCACTA 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938720_1055938737 29 Left 1055938720 9:81628218-81628240 CCCTCCCACCTGAGGCCTCCTAA 0: 1
1: 0
2: 4
3: 30
4: 302
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938729_1055938737 5 Left 1055938729 9:81628242-81628264 CCCCTCCCTGTGAGGCAACCACT 0: 1
1: 0
2: 0
3: 15
4: 241
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data
1055938727_1055938737 11 Left 1055938727 9:81628236-81628258 CCTAACCCCCTCCCTGTGAGGCA 0: 1
1: 0
2: 1
3: 48
4: 523
Right 1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055938737 Original CRISPR CACCATTTATAGATGGGACT AGG Intronic
No off target data available for this crispr