ID: 1055938756

View in Genome Browser
Species Human (GRCh38)
Location 9:81628401-81628423
Sequence GTTCATTCCCGGAGGCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055938756 Original CRISPR GTTCATTCCCGGAGGCCTAT GGG (reversed) Intronic
900401020 1:2472911-2472933 GTACATGCCGGGAGGCCTGTGGG + Intronic
901629453 1:10641137-10641159 GTCCACTCCGGGTGGCCTATGGG - Intronic
904623883 1:31791283-31791305 GTTCTTCCCCGCAGGCCTTTGGG - Exonic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
920178655 1:204119097-204119119 GGAAATTCCCTGAGGCCTATAGG + Intronic
921969810 1:221135747-221135769 ACTCATGCCCGGAGGCCTGTGGG + Intergenic
1072237573 10:93466414-93466436 GGTCATTCCCAGAGGCCAGTGGG - Intronic
1074593275 10:114835532-114835554 TTTCATTCCCGGAGGACACTGGG - Exonic
1075804099 10:125172929-125172951 GTTAATTCCCTGTGACCTATTGG - Intergenic
1092670327 12:10854472-10854494 GCACATTCCCAGAGGCCTAAAGG + Intronic
1096929329 12:55188160-55188182 GTTCAGTCCAAAAGGCCTATTGG - Intergenic
1098242254 12:68480174-68480196 GTTCATTCCCAGAGGCACATGGG + Intergenic
1129082214 15:73051835-73051857 GTTTCCTCCCGGAGGCCTTTCGG + Exonic
1145204738 17:20977174-20977196 GTTCATTGACGGTGGCCTAATGG + Intergenic
1150622921 17:66821950-66821972 GTTCATTCCCACAGGACTTTTGG - Intergenic
1157183893 18:45521901-45521923 GTATTTTCCCAGAGGCCTATGGG + Intronic
1158542963 18:58373484-58373506 GTTCATGCCCCAAGGCCTCTTGG - Intronic
1159524700 18:69573019-69573041 GATCATTCCCATAGGCCTACAGG - Intronic
927152253 2:20202912-20202934 GGTCATTGCCGGAGGCCTCGTGG - Exonic
930393979 2:50796523-50796545 GTTAATTCTCTGAGGCCTAAAGG + Intronic
940959606 2:159769662-159769684 CTTCATTACCAGAGGCCTCTTGG + Exonic
1179355278 21:40653049-40653071 TGTCTTTCCCGGAGACCTATAGG - Intronic
1179600863 21:42476466-42476488 ATTCTTTCACGGAGGCCAATCGG + Intronic
951004887 3:17604029-17604051 GTTCAGTCCAGGAGGCCATTTGG - Intronic
961910752 3:130313863-130313885 GGTCATTCCCAGAGTCCTAGAGG + Intergenic
962889670 3:139660229-139660251 GTTAATTCCCGGTGGACCATAGG - Intronic
966318052 3:178670903-178670925 GTACATTCCCAGAGGCCTCTAGG - Intronic
972811923 4:42598726-42598748 TCTCATTCCCAGTGGCCTATGGG - Intronic
977706363 4:100075416-100075438 CTTCATTCAAGGAGGTCTATGGG - Intergenic
984539581 4:181021268-181021290 GTTCATTCCAGGAGGCCATGTGG + Intergenic
992013122 5:72550536-72550558 GCTCACTCCCAGAGGCCTTTGGG - Intergenic
993307146 5:86287714-86287736 CTTCATTCACGGAGTCCTCTGGG - Intergenic
1014186966 6:118445754-118445776 GTTCATGCCCAGGGGCCTGTGGG + Intergenic
1019051372 6:169186229-169186251 GTTCCTGCACGGAGGCCTCTAGG + Intergenic
1055938756 9:81628401-81628423 GTTCATTCCCGGAGGCCTATGGG - Intronic
1190777330 X:53563459-53563481 GTTTATTCATGGAGGCCTAGAGG - Intronic
1196947222 X:120839669-120839691 GTTCTTTCCTGGAGGGCTAATGG - Intergenic