ID: 1055939256

View in Genome Browser
Species Human (GRCh38)
Location 9:81634227-81634249
Sequence TCCCGAAGGGTGAGGCGTAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 52}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055939251_1055939256 -9 Left 1055939251 9:81634213-81634235 CCAGGAGGCTGAAGTCCCGAAGG 0: 2
1: 0
2: 2
3: 10
4: 165
Right 1055939256 9:81634227-81634249 TCCCGAAGGGTGAGGCGTAAGGG 0: 2
1: 0
2: 0
3: 3
4: 52
1055939248_1055939256 7 Left 1055939248 9:81634197-81634219 CCCGAGGGGCGGGATTCCAGGAG 0: 2
1: 0
2: 0
3: 21
4: 903
Right 1055939256 9:81634227-81634249 TCCCGAAGGGTGAGGCGTAAGGG 0: 2
1: 0
2: 0
3: 3
4: 52
1055939249_1055939256 6 Left 1055939249 9:81634198-81634220 CCGAGGGGCGGGATTCCAGGAGG 0: 2
1: 0
2: 2
3: 15
4: 197
Right 1055939256 9:81634227-81634249 TCCCGAAGGGTGAGGCGTAAGGG 0: 2
1: 0
2: 0
3: 3
4: 52
1055939245_1055939256 9 Left 1055939245 9:81634195-81634217 CCCCCGAGGGGCGGGATTCCAGG 0: 2
1: 0
2: 0
3: 15
4: 167
Right 1055939256 9:81634227-81634249 TCCCGAAGGGTGAGGCGTAAGGG 0: 2
1: 0
2: 0
3: 3
4: 52
1055939247_1055939256 8 Left 1055939247 9:81634196-81634218 CCCCGAGGGGCGGGATTCCAGGA 0: 2
1: 0
2: 0
3: 5
4: 100
Right 1055939256 9:81634227-81634249 TCCCGAAGGGTGAGGCGTAAGGG 0: 2
1: 0
2: 0
3: 3
4: 52
1055939242_1055939256 18 Left 1055939242 9:81634186-81634208 CCGGCACTGCCCCCGAGGGGCGG 0: 2
1: 0
2: 2
3: 11
4: 171
Right 1055939256 9:81634227-81634249 TCCCGAAGGGTGAGGCGTAAGGG 0: 2
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055939256 Original CRISPR TCCCGAAGGGTGAGGCGTAA GGG Exonic
901160391 1:7172808-7172830 CCCTGGAGGGTGAGGCGTGAGGG + Intronic
911733814 1:101315849-101315871 TTCCCAAGGGTGAGGCTGAACGG - Intergenic
1066095918 10:32071961-32071983 ACCCGCAGGGAGAGGGGTAAGGG - Intergenic
1072946073 10:99811070-99811092 TCCCAAAGGGTGAGGATTACAGG - Intronic
1073255319 10:102147123-102147145 TCCGGCAGGGTGAGGCCTCAGGG - Exonic
1075589852 10:123683615-123683637 TCCCCATGGGTGAGGAGCAAGGG + Intronic
1084543646 11:69802755-69802777 TGCAGAAGGGTGAGGCCTGAAGG - Intergenic
1084606015 11:70172264-70172286 TCCAGGAGGGTGAGGGGTATGGG + Intronic
1090559842 11:127920139-127920161 TCCAGAAGGGGGAGGAGTAAAGG - Intergenic
1094194797 12:27737116-27737138 TCCCGGAGGGTGAGGTGGGAGGG - Intronic
1097195900 12:57242424-57242446 TCCAGAAGGCTGAGGTGTGATGG - Intergenic
1106507770 13:30386532-30386554 TCCCAAAGTGTTAGGAGTAAAGG - Intergenic
1111401827 13:87747661-87747683 ACTCGAAGGTTGAGGGGTAAGGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1123850357 15:24349773-24349795 TCTCGAAAGGAGAGGCCTAAAGG + Intergenic
1123855292 15:24404331-24404353 TCTCGAAAGGAGAGGCCTAAAGG + Intergenic
1130077300 15:80700269-80700291 GCCCGAAGAATGAGGTGTAAAGG + Intronic
1152358875 17:79820894-79820916 TCCCGAAGTGTGAGGATTATAGG + Intergenic
1153459298 18:5316086-5316108 TCACAAATGGTGAGGGGTAAGGG - Intergenic
1157034803 18:43958607-43958629 TACCAAAGGATGAGGAGTAAGGG + Intergenic
1159868133 18:73730149-73730171 TCTAGAAGGGTGTGGTGTAATGG - Intergenic
1161196028 19:2987246-2987268 TCCCTGAGGGTGAGGGGGAAGGG + Intronic
1167992932 19:53375985-53376007 TCCCCAAGGGTGGGGTGCAATGG + Intronic
925196262 2:1928612-1928634 TTCCGAATGGTGAGGCAGAAGGG - Intronic
926376560 2:12234568-12234590 TGCAGAGGGGTGAGGAGTAAAGG - Intergenic
932543758 2:72685442-72685464 TCCCAAAGGATGAGCCGAAAAGG + Intronic
944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG + Exonic
946871315 2:224088259-224088281 TCCTGAAGATTGAGGCATAAGGG + Intergenic
1172778960 20:37424527-37424549 TCCAGAAGGGTGCAGAGTAAGGG + Intergenic
1175880885 20:62258166-62258188 TCCCCAAGGATGAGGTGGAAGGG + Intronic
1179829932 21:43990119-43990141 TCCCAAAGTGTGAGGCTTACAGG - Intergenic
954787450 3:53104485-53104507 TCCCAAAGCGTGAGGCTTACAGG + Intronic
954805886 3:53220233-53220255 TCCCCAGGGGTGGGGGGTAAAGG - Intergenic
954860262 3:53682283-53682305 TTCAGAAGGGTGAGGTGGAAGGG + Intronic
955780940 3:62483577-62483599 TCCCAAAATGTGAGGTGTAAAGG - Intronic
958798642 3:98732562-98732584 TCCCGGAGGGTGAGGCGTTGGGG - Intronic
961098825 3:124180970-124180992 TCCCGAAGGGCTAGGAGTACAGG - Intronic
961263817 3:125624147-125624169 TCCCGAAGTGTGAGGATTACAGG - Intergenic
961980591 3:131073973-131073995 GCCCAAAGGGTGAGGAGTAATGG - Intronic
965110088 3:164409834-164409856 TGCCAAAGGGTGAGGGGCAAAGG - Intergenic
969305229 4:6322486-6322508 TGCTGAAGGGTGAGGCGGCAGGG + Exonic
972687048 4:41361377-41361399 TCCGGAAGGGTGCGGGGTAGGGG - Intronic
991359208 5:65802587-65802609 TGCCGAATGGTGGGGCCTAAAGG - Intronic
996308386 5:122077078-122077100 GGGCGAAGGGTGAGGAGTAAGGG - Intronic
1006081659 6:31571448-31571470 TCCACATGGGTGAGGCTTAAGGG - Intergenic
1011484101 6:87824287-87824309 TCCAGAAGGTTGAGGCAGAATGG + Intergenic
1024241062 7:47436426-47436448 TCATGAAGGGTGAGGGGCAAGGG + Intronic
1024353935 7:48395327-48395349 TCCAGTAGGGTGAGGAGGAAAGG + Intronic
1028596914 7:92555334-92555356 TCCCAAAGGGTTAGGAGTACAGG + Intergenic
1029386713 7:100248253-100248275 TCCCGAAGGGTTAGGATTACAGG + Intronic
1035435532 7:158856642-158856664 TCCCGAAGGGTGCGGGGCACAGG + Exonic
1045992775 8:108329227-108329249 TCCCAAAGTGTGAGGATTAAAGG + Intronic
1048306818 8:133290199-133290221 TCCCACAGGGTGAGGCTGAAGGG + Intronic
1055939256 9:81634227-81634249 TCCCGAAGGGTGAGGCGTAAGGG + Exonic
1191830391 X:65408507-65408529 TCCCGAAGGGTGAGGCGTAAGGG - Intronic
1195966217 X:110432396-110432418 TCCCCAAGGGTGAGTGGTAGTGG + Intronic
1198435790 X:136615739-136615761 TACCGAAGGGTTGGGAGTAAGGG - Intergenic