ID: 1055946506

View in Genome Browser
Species Human (GRCh38)
Location 9:81695960-81695982
Sequence TGTTATGTGAATATGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055946506_1055946508 -10 Left 1055946506 9:81695960-81695982 CCTTCCTACATATTCACATAACA No data
Right 1055946508 9:81695973-81695995 TCACATAACAAGAGCAGACCTGG No data
1055946506_1055946514 30 Left 1055946506 9:81695960-81695982 CCTTCCTACATATTCACATAACA No data
Right 1055946514 9:81696013-81696035 GCTTGAGCCACCTTTGCTGCAGG No data
1055946506_1055946509 -9 Left 1055946506 9:81695960-81695982 CCTTCCTACATATTCACATAACA No data
Right 1055946509 9:81695974-81695996 CACATAACAAGAGCAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055946506 Original CRISPR TGTTATGTGAATATGTAGGA AGG (reversed) Intergenic
No off target data available for this crispr