ID: 1055953336

View in Genome Browser
Species Human (GRCh38)
Location 9:81751152-81751174
Sequence CTGTGGGAGGCGGAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055953336_1055953343 -8 Left 1055953336 9:81751152-81751174 CCGTCCACCTCCGCCTCCCACAG No data
Right 1055953343 9:81751167-81751189 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055953336 Original CRISPR CTGTGGGAGGCGGAGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr