ID: 1055953343 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:81751167-81751189 |
Sequence | TCCCACAGTGCTGGGATTAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 842078 | |||
Summary | {0: 2641, 1: 295980, 2: 261775, 3: 149501, 4: 132181} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1055953334_1055953343 | 6 | Left | 1055953334 | 9:81751138-81751160 | CCTGACCTCGTGATCCGTCCACC | 0: 125 1: 6846 2: 37415 3: 60758 4: 61005 |
||
Right | 1055953343 | 9:81751167-81751189 | TCCCACAGTGCTGGGATTACAGG | 0: 2641 1: 295980 2: 261775 3: 149501 4: 132181 |
||||
1055953335_1055953343 | 1 | Left | 1055953335 | 9:81751143-81751165 | CCTCGTGATCCGTCCACCTCCGC | 0: 3 1: 181 2: 6339 3: 35159 4: 61046 |
||
Right | 1055953343 | 9:81751167-81751189 | TCCCACAGTGCTGGGATTACAGG | 0: 2641 1: 295980 2: 261775 3: 149501 4: 132181 |
||||
1055953336_1055953343 | -8 | Left | 1055953336 | 9:81751152-81751174 | CCGTCCACCTCCGCCTCCCACAG | No data | ||
Right | 1055953343 | 9:81751167-81751189 | TCCCACAGTGCTGGGATTACAGG | 0: 2641 1: 295980 2: 261775 3: 149501 4: 132181 |
||||
1055953333_1055953343 | 24 | Left | 1055953333 | 9:81751120-81751142 | CCAGGATGGTCTTGATCTCCTGA | 0: 13198 1: 65917 2: 109206 3: 154763 4: 167714 |
||
Right | 1055953343 | 9:81751167-81751189 | TCCCACAGTGCTGGGATTACAGG | 0: 2641 1: 295980 2: 261775 3: 149501 4: 132181 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1055953343 | Original CRISPR | TCCCACAGTGCTGGGATTAC AGG | Intergenic | ||
Too many off-targets to display for this crispr |