ID: 1055953343

View in Genome Browser
Species Human (GRCh38)
Location 9:81751167-81751189
Sequence TCCCACAGTGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 842078
Summary {0: 2641, 1: 295980, 2: 261775, 3: 149501, 4: 132181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055953334_1055953343 6 Left 1055953334 9:81751138-81751160 CCTGACCTCGTGATCCGTCCACC 0: 125
1: 6846
2: 37415
3: 60758
4: 61005
Right 1055953343 9:81751167-81751189 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
1055953335_1055953343 1 Left 1055953335 9:81751143-81751165 CCTCGTGATCCGTCCACCTCCGC 0: 3
1: 181
2: 6339
3: 35159
4: 61046
Right 1055953343 9:81751167-81751189 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
1055953336_1055953343 -8 Left 1055953336 9:81751152-81751174 CCGTCCACCTCCGCCTCCCACAG No data
Right 1055953343 9:81751167-81751189 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
1055953333_1055953343 24 Left 1055953333 9:81751120-81751142 CCAGGATGGTCTTGATCTCCTGA 0: 13198
1: 65917
2: 109206
3: 154763
4: 167714
Right 1055953343 9:81751167-81751189 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055953343 Original CRISPR TCCCACAGTGCTGGGATTAC AGG Intergenic
Too many off-targets to display for this crispr