ID: 1055960108

View in Genome Browser
Species Human (GRCh38)
Location 9:81812271-81812293
Sequence GTACCTATTAAAATTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055960105_1055960108 4 Left 1055960105 9:81812244-81812266 CCCAGCCTATAAACAGTCTTAAT No data
Right 1055960108 9:81812271-81812293 GTACCTATTAAAATTAAAGCTGG No data
1055960106_1055960108 3 Left 1055960106 9:81812245-81812267 CCAGCCTATAAACAGTCTTAATA No data
Right 1055960108 9:81812271-81812293 GTACCTATTAAAATTAAAGCTGG No data
1055960104_1055960108 12 Left 1055960104 9:81812236-81812258 CCACTGCGCCCAGCCTATAAACA No data
Right 1055960108 9:81812271-81812293 GTACCTATTAAAATTAAAGCTGG No data
1055960107_1055960108 -1 Left 1055960107 9:81812249-81812271 CCTATAAACAGTCTTAATAGCAG No data
Right 1055960108 9:81812271-81812293 GTACCTATTAAAATTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055960108 Original CRISPR GTACCTATTAAAATTAAAGC TGG Intergenic
No off target data available for this crispr