ID: 1055963623

View in Genome Browser
Species Human (GRCh38)
Location 9:81844072-81844094
Sequence GACAATTATTTCAATCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055963623_1055963628 -10 Left 1055963623 9:81844072-81844094 CCCACTGGATTGAAATAATTGTC No data
Right 1055963628 9:81844085-81844107 AATAATTGTCTACGGGGTCCTGG No data
1055963623_1055963630 -8 Left 1055963623 9:81844072-81844094 CCCACTGGATTGAAATAATTGTC No data
Right 1055963630 9:81844087-81844109 TAATTGTCTACGGGGTCCTGGGG No data
1055963623_1055963629 -9 Left 1055963623 9:81844072-81844094 CCCACTGGATTGAAATAATTGTC No data
Right 1055963629 9:81844086-81844108 ATAATTGTCTACGGGGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055963623 Original CRISPR GACAATTATTTCAATCCAGT GGG (reversed) Intergenic
No off target data available for this crispr