ID: 1055967452

View in Genome Browser
Species Human (GRCh38)
Location 9:81879541-81879563
Sequence AATGGCTTTGTAAACTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055967452_1055967453 -9 Left 1055967452 9:81879541-81879563 CCTTCATAGTTTACAAAGCCATT No data
Right 1055967453 9:81879555-81879577 AAAGCCATTTAAGAGAACAATGG No data
1055967452_1055967456 6 Left 1055967452 9:81879541-81879563 CCTTCATAGTTTACAAAGCCATT No data
Right 1055967456 9:81879570-81879592 AACAATGGGTTGCAAACAATAGG No data
1055967452_1055967454 -8 Left 1055967452 9:81879541-81879563 CCTTCATAGTTTACAAAGCCATT No data
Right 1055967454 9:81879556-81879578 AAGCCATTTAAGAGAACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055967452 Original CRISPR AATGGCTTTGTAAACTATGA AGG (reversed) Intergenic
No off target data available for this crispr