ID: 1055968992

View in Genome Browser
Species Human (GRCh38)
Location 9:81892921-81892943
Sequence AAATCAGTAGTACAACATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055968983_1055968992 22 Left 1055968983 9:81892876-81892898 CCCTCTCTATTTTCATTGCTTTC No data
Right 1055968992 9:81892921-81892943 AAATCAGTAGTACAACATTTTGG No data
1055968987_1055968992 -5 Left 1055968987 9:81892903-81892925 CCCAAAACCTCCTTTGCCAAATC No data
Right 1055968992 9:81892921-81892943 AAATCAGTAGTACAACATTTTGG No data
1055968984_1055968992 21 Left 1055968984 9:81892877-81892899 CCTCTCTATTTTCATTGCTTTCC No data
Right 1055968992 9:81892921-81892943 AAATCAGTAGTACAACATTTTGG No data
1055968982_1055968992 23 Left 1055968982 9:81892875-81892897 CCCCTCTCTATTTTCATTGCTTT No data
Right 1055968992 9:81892921-81892943 AAATCAGTAGTACAACATTTTGG No data
1055968988_1055968992 -6 Left 1055968988 9:81892904-81892926 CCAAAACCTCCTTTGCCAAATCA No data
Right 1055968992 9:81892921-81892943 AAATCAGTAGTACAACATTTTGG No data
1055968986_1055968992 -4 Left 1055968986 9:81892902-81892924 CCCCAAAACCTCCTTTGCCAAAT No data
Right 1055968992 9:81892921-81892943 AAATCAGTAGTACAACATTTTGG No data
1055968985_1055968992 0 Left 1055968985 9:81892898-81892920 CCTTCCCCAAAACCTCCTTTGCC No data
Right 1055968992 9:81892921-81892943 AAATCAGTAGTACAACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055968992 Original CRISPR AAATCAGTAGTACAACATTT TGG Intergenic