ID: 1055977844

View in Genome Browser
Species Human (GRCh38)
Location 9:81971987-81972009
Sequence ACTTGCATGCAGATGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055977844_1055977849 -6 Left 1055977844 9:81971987-81972009 CCAAGCCCCATCTGCATGCAAGT 0: 1
1: 0
2: 3
3: 19
4: 176
Right 1055977849 9:81972004-81972026 GCAAGTATGCCAGGTGCCCCTGG 0: 1
1: 0
2: 2
3: 9
4: 141
1055977844_1055977854 16 Left 1055977844 9:81971987-81972009 CCAAGCCCCATCTGCATGCAAGT 0: 1
1: 0
2: 3
3: 19
4: 176
Right 1055977854 9:81972026-81972048 GCTGACATTAAACCAGCTTAAGG 0: 1
1: 0
2: 1
3: 9
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055977844 Original CRISPR ACTTGCATGCAGATGGGGCT TGG (reversed) Intergenic
901740637 1:11339567-11339589 AGTTGCCTCCAGCTGGGGCTGGG + Intergenic
905271194 1:36788838-36788860 ACCTGCAGGCAAGTGGGGCTGGG + Intergenic
905304731 1:37009757-37009779 AATGGTATGCAAATGGGGCTGGG + Intronic
906203080 1:43972240-43972262 ACTTCCAGGCAGGTGGGGGTCGG - Exonic
906247644 1:44288398-44288420 TCTCTCATGAAGATGGGGCTGGG - Intronic
908352727 1:63302072-63302094 AATTGCATGCTGATGTTGCTAGG - Intergenic
912458851 1:109818076-109818098 ACCTGGACTCAGATGGGGCTGGG + Intergenic
912707232 1:111923897-111923919 ACCACCATGCAGAGGGGGCTGGG + Intronic
916959881 1:169878582-169878604 ACTTTGATGTAGATGGGGGTGGG - Intronic
919012722 1:191986170-191986192 AATTGCATCCACATGGGGATTGG - Intergenic
920106677 1:203558145-203558167 GCTTGCAAGCAGCTGGAGCTAGG - Intergenic
920502236 1:206492759-206492781 ACATGCATGTGGCTGGGGCTGGG - Exonic
922766107 1:228157420-228157442 ACCTGGATGCGGCTGGGGCTGGG + Intronic
923047496 1:230366319-230366341 GATTACCTGCAGATGGGGCTGGG + Intronic
923602948 1:235419725-235419747 ACTTGCAAGCAAAGGGGTCTGGG - Intronic
924165079 1:241272560-241272582 GCCTGGATACAGATGGGGCTAGG - Intronic
1067437898 10:46291833-46291855 AGTCCCAGGCAGATGGGGCTGGG + Intronic
1067680124 10:48429410-48429432 ACTGACATGCACCTGGGGCTAGG - Intronic
1070775765 10:79108882-79108904 ACATGCATGCACAGGGGCCTCGG - Intronic
1071040379 10:81301738-81301760 AATTGCATGCAGCTGGGGTTTGG + Intergenic
1073081022 10:100860816-100860838 GCTTGGCTGCAGATGAGGCTGGG + Intergenic
1074387503 10:113028306-113028328 ACTTGCATGCAGGGGGGTCGTGG + Intronic
1074549537 10:114429816-114429838 AATTACATGCAGATTGGGCTGGG + Intergenic
1076024417 10:127100379-127100401 TGTGGCATGCAGCTGGGGCTTGG + Intronic
1076814043 10:132905890-132905912 CCTTCCTTGCAGGTGGGGCTGGG - Intronic
1077212420 11:1377684-1377706 AGTTGCAAGCAGATGGGGGATGG + Intergenic
1077248274 11:1549479-1549501 CCCTGCAGGCAGCTGGGGCTCGG - Intergenic
1078078607 11:8185395-8185417 ACATGCATGCAGATACAGCTAGG + Intergenic
1078098157 11:8313049-8313071 CCGTGGATGCAGATGGGGCGGGG - Intergenic
1078126122 11:8565293-8565315 ACTTCCAGGGAGATGGGGGTTGG - Intronic
1078427687 11:11265129-11265151 CCCTGCATGCTGATGGGGCTGGG + Intergenic
1078652148 11:13205930-13205952 ACTTGAATGCAGAGAAGGCTGGG - Intergenic
1078877825 11:15415728-15415750 ACTGGCAAGCAGATGGGTCGTGG - Intergenic
1078909262 11:15715948-15715970 ACATGCATTCACAAGGGGCTGGG - Intergenic
1080394416 11:31876577-31876599 ACATGCGTGCACATGGAGCTGGG + Intronic
1081907165 11:46677437-46677459 CCTGGCTTGCGGATGGGGCTGGG + Exonic
1084825693 11:71729959-71729981 ACATTCTTGCAGGTGGGGCTGGG - Intergenic
1087346894 11:96982917-96982939 AAATGAATGCAGATGGGGCCTGG - Intergenic
1091126159 11:133100254-133100276 AATTGCATGTTGCTGGGGCTTGG - Intronic
1091475640 12:769495-769517 ACAAGGATGCAGAAGGGGCTAGG - Intronic
1092783595 12:12008793-12008815 AGTTGCATGTGGGTGGGGCTGGG - Intergenic
1094408807 12:30148023-30148045 AATTGCATTCTGAGGGGGCTTGG + Intergenic
1096254802 12:50056495-50056517 ACTTGCAGGCTGGTGCGGCTCGG - Intergenic
1097661081 12:62432534-62432556 ACTGGCATTCACTTGGGGCTGGG - Intergenic
1097776514 12:63652860-63652882 AATTGCATGCAGTGGGGGTTTGG - Intronic
1099580064 12:84434788-84434810 ACTTCCATGCATATGGGTCATGG - Intergenic
1099997087 12:89789826-89789848 ACTTACATGTAGATGAAGCTAGG + Intergenic
1101420546 12:104547241-104547263 AGTTGCAGGCAGATGGGCCAAGG + Intronic
1101846190 12:108365035-108365057 CCTTGTTTGCAGATGGTGCTTGG - Intergenic
1111781433 13:92730946-92730968 ACTTGCATGGAGATGAGATTAGG + Intronic
1112432300 13:99360701-99360723 ACTTCCAAGAGGATGGGGCTGGG - Intronic
1112635258 13:101210181-101210203 ATGTGCATGCAGATGGGGGTGGG - Intronic
1114886599 14:26859356-26859378 ATTTGCATGTAGATGGGTGTGGG + Intergenic
1117942670 14:60985169-60985191 ACTAGCAGGCAGATGGGGGCAGG - Intronic
1118136390 14:63032924-63032946 ATTTGCGTGCAGATGGAGGTAGG - Intronic
1118727489 14:68639432-68639454 CCTTGCATGCAGGAGGGGCCAGG - Intronic
1119729642 14:76942922-76942944 ACCTGCATGGAGGTGGGGGTGGG - Intergenic
1122969110 14:105145280-105145302 ACTGGCCTGCAGGTGGAGCTGGG - Intronic
1126863533 15:52912402-52912424 ATTTGCATTTAGGTGGGGCTAGG + Intergenic
1128555499 15:68628971-68628993 ATTTGCCTCCAGATGGGGCAGGG + Intronic
1129714132 15:77837146-77837168 ACTTACAAGCAGATGGGACTGGG + Intergenic
1130561263 15:84961157-84961179 CCTTGCATTCAGATAAGGCTAGG - Intergenic
1132791306 16:1690226-1690248 GCTTGCGTGGAGATGAGGCTCGG - Intronic
1132911728 16:2317220-2317242 ATTTCCATGCAGATGGCCCTTGG + Intronic
1137383682 16:48022124-48022146 ACTTGCACGCAGTATGGGCTGGG - Intergenic
1137565124 16:49528006-49528028 GCTTGCCTGCAGGAGGGGCTTGG + Intronic
1138217652 16:55218532-55218554 ACTTCCAGGCAGCTGGGTCTTGG - Intergenic
1140211135 16:72971475-72971497 ACTAGCATGCAGCTTGGGCAAGG - Intronic
1140327680 16:74021734-74021756 ACTTGCATGGAAATGGTGCCTGG + Intergenic
1140896294 16:79327428-79327450 TCTTGGAGGCAGATGGGTCTGGG + Intergenic
1141847109 16:86618399-86618421 ACCTGCAGGCAGTTGGGGTTGGG - Intergenic
1142521488 17:507883-507905 ACTGGGATGGAGAAGGGGCTTGG - Intergenic
1144642066 17:16943104-16943126 TCTGTCATGCAGATGGTGCTGGG - Intronic
1146211484 17:30946915-30946937 ATTGGCATGGAGAGGGGGCTAGG - Intronic
1149498938 17:57136634-57136656 AGGTGCTTGGAGATGGGGCTGGG + Intergenic
1152927463 17:83093847-83093869 CCTGGCATGGAGTTGGGGCTGGG + Intronic
1153094301 18:1383323-1383345 ACTTGCACCCTGATGGGGCAAGG - Intergenic
1158233001 18:55279550-55279572 CCTTGCATGAAGAAGGAGCTAGG + Exonic
1160179962 18:76625499-76625521 ACTTGCATGCAGGAATGGCTGGG - Intergenic
1161310545 19:3591658-3591680 ACTTGGATGCAACTGGGGTTGGG - Exonic
1161489701 19:4555234-4555256 GCTTGGATGGAGGTGGGGCTTGG - Intronic
1164144754 19:22505140-22505162 TCTTGTATGCAGCAGGGGCTTGG + Intronic
1165382454 19:35490672-35490694 CTCTTCATGCAGATGGGGCTGGG + Intronic
1166849695 19:45753596-45753618 AGTTGGATGCAGATGGGGTGGGG + Intronic
1167496825 19:49824336-49824358 ATTTGCTTCCAGCTGGGGCTTGG + Intronic
1168589924 19:57624763-57624785 ACCTGGATGCTGCTGGGGCTGGG + Intergenic
925847480 2:8046825-8046847 ACTTTCATGAAGGTGGAGCTGGG - Intergenic
928585222 2:32753058-32753080 AGTTGCAATCAGATGGTGCTGGG + Intronic
929574072 2:43041358-43041380 CCCTGAATGGAGATGGGGCTGGG - Intergenic
930060372 2:47283624-47283646 ACTCCCATGCCCATGGGGCTCGG - Intergenic
931085859 2:58830305-58830327 AGCTGCCTGCAGCTGGGGCTGGG + Intergenic
932748024 2:74350775-74350797 ACTTGCTTCCAGATGGGGTTGGG - Intronic
932931335 2:76043153-76043175 ACTTGTAGGCAGATGGTGATGGG + Intergenic
933190389 2:79327789-79327811 ACCTGGATGCAGAAGGGGCAGGG + Intronic
937321246 2:120962033-120962055 ACTTGCATGGAATCGGGGCTGGG - Intronic
940523080 2:154776356-154776378 ACTTCCTAGCAGATGGGGGTTGG - Intronic
941196507 2:162459457-162459479 ACCTGATTGCAAATGGGGCTGGG - Intronic
941923279 2:170872493-170872515 CCTTCCATGCAGATGTGGCCTGG + Intergenic
942073340 2:172335085-172335107 CCTGGCATGCAAATGGGGCCTGG - Intergenic
945393492 2:209293770-209293792 AATTGCATGCTGCTGAGGCTTGG - Intergenic
945656380 2:212628761-212628783 AATTGCATGCAGTATGGGCTGGG + Intergenic
946885967 2:224222883-224222905 ATTTGAAGGCAGATGGGGATGGG + Intergenic
947324245 2:228957277-228957299 ACGTGCTTGCAGCTGGGGCCTGG + Intronic
1168861209 20:1047271-1047293 ACCTGCATGCAAATAGGGCTGGG - Intergenic
1169353916 20:4892148-4892170 CCTTGGATGCAGAGGCGGCTGGG - Intronic
1170326907 20:15166069-15166091 TCTTGCATGCAGCTGGGGGTAGG + Intronic
1172732216 20:37097504-37097526 AAATGCATGCAGGTGAGGCTGGG - Intergenic
1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG + Intergenic
1175240830 20:57547446-57547468 ACTTGAAAGGAGATGGAGCTTGG + Intergenic
1176113358 20:63420734-63420756 TCTTGCAGGCTGGTGGGGCTTGG - Intronic
1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG + Intergenic
1177815705 21:25974272-25974294 ACTTACATGATGAGGGGGCTGGG + Intronic
1179731705 21:43371887-43371909 GCTTGCATAGAGATGGGGTTGGG + Intergenic
1180965158 22:19784396-19784418 CCCTGCAGGCAGATTGGGCTTGG - Exonic
1182436244 22:30332315-30332337 ACTTGCATGCAGAGGGCTCCAGG - Exonic
1183623284 22:38987032-38987054 GCTTGCACTCAGATGGGCCTGGG + Intronic
1185410469 22:50678953-50678975 TCTTGCCTGGTGATGGGGCTGGG + Intergenic
949638575 3:6011033-6011055 CCTTGCATGAAGAGGAGGCTAGG + Intergenic
952210774 3:31227096-31227118 ACTTCCACACATATGGGGCTGGG + Intergenic
953668059 3:44940222-44940244 ATGTGCATGCAGTGGGGGCTGGG - Intronic
954224665 3:49174079-49174101 ACCTGCCTGCAGTGGGGGCTGGG - Intronic
954757716 3:52850690-52850712 GCTTGACTGCAGATGGGGATGGG - Intronic
955142680 3:56285208-56285230 AGTTTCAAGCAGATGGGGCTAGG + Intronic
968376462 4:46796-46818 ACTTGTAGGCAGATGCAGCTGGG - Intergenic
969747653 4:9086788-9086810 ACCTTCTTGCAGGTGGGGCTGGG - Intergenic
969808699 4:9631311-9631333 ACCTTCTTGCAGGTGGGGCTGGG - Intergenic
970756900 4:19437636-19437658 ACGTGAATGCAGCTAGGGCTGGG + Intergenic
972140464 4:35953062-35953084 AATTGCATGTAGCTGGGGTTTGG + Intronic
972200530 4:36709288-36709310 ACTTGGATACAGATGGGGGTGGG - Intergenic
973824137 4:54688149-54688171 AATAGCATGCAGATGGGGGAGGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
979698823 4:123643876-123643898 ACTTGCATTCTTATGGGGCTAGG + Intergenic
979820473 4:125163570-125163592 ACATGTATGACGATGGGGCTTGG - Intergenic
979963076 4:127044826-127044848 AACAGCATGGAGATGGGGCTAGG - Intergenic
983234146 4:165159948-165159970 ACTAGCATGGAGATGGGGCTAGG - Intronic
985707991 5:1412686-1412708 TGTTGCAGGCAGATTGGGCTTGG - Intronic
987204506 5:15611001-15611023 GCTTACATGTAGATGGGGATAGG - Intronic
987964105 5:24850307-24850329 ATTTGCATGCAGAGGGGGAGTGG - Intergenic
988702493 5:33689332-33689354 AGTGGCATGGAGATGGGGATGGG + Intronic
989726338 5:44591014-44591036 TGTTGCATGCAGGTGGGGCCTGG + Intergenic
994164350 5:96593115-96593137 AATTGGATGCAGATGGGTATGGG - Intronic
996387923 5:122928359-122928381 CCTTACATGCAGAAGGGACTTGG + Intronic
996573961 5:124962278-124962300 ACTTGGCTGGAGATGAGGCTTGG - Intergenic
996734605 5:126747234-126747256 CATTGCATGGTGATGGGGCTGGG + Intergenic
996883977 5:128334077-128334099 TTTTGCATGCAGGTGGGGCTAGG - Intronic
997199235 5:131999736-131999758 CCCTGCATGCAGATGGAGGTGGG - Intronic
997532580 5:134591333-134591355 GCTAGCTGGCAGATGGGGCTGGG + Intergenic
997862024 5:137426993-137427015 ACCTACATGCAGAGGGGTCTGGG - Intronic
998149369 5:139748096-139748118 ACGTGAATACAGATGTGGCTCGG - Intergenic
1001657080 5:173359401-173359423 ACTTCCAGGGAGATAGGGCTGGG - Intergenic
1001742597 5:174066239-174066261 ACTTGTACGCAGCTGGGTCTTGG - Intronic
1002326618 5:178414012-178414034 ACCAGCCTGCAGCTGGGGCTAGG + Intronic
1002614011 5:180439198-180439220 ACTGGCATGGAGATGGGGCTGGG - Intergenic
1006838506 6:37013754-37013776 ACTCGCATCCAGGTGAGGCTGGG + Exonic
1007160935 6:39791480-39791502 ATTTGCTTGCAGAGGGAGCTGGG + Intergenic
1010805299 6:80228739-80228761 ACATGCCTGCACATGTGGCTCGG - Intronic
1012258741 6:97063418-97063440 AATTGCAGGCAGAAGGGGTTGGG + Intronic
1013278415 6:108609387-108609409 ACTTGGTTGCTGATGGGCCTGGG + Intronic
1020988796 7:15169792-15169814 ACTTGTCTGCAGATGGGACTTGG - Intergenic
1022935425 7:35170464-35170486 AATTGCATGCAGTGGGGGTTTGG - Intergenic
1024223318 7:47304690-47304712 ACTGGCCTGAAGATGGGGCGGGG - Intronic
1025205171 7:56988793-56988815 ATTTTCATGCAGATGGGGTGGGG + Intergenic
1025666767 7:63588141-63588163 ATTTTCATGCAGATGGGGTGGGG - Intergenic
1029831384 7:103263233-103263255 AATTGCATGCAGTGGGGGTTTGG - Intergenic
1033686565 7:143646207-143646229 ACTTTCAAGAAGATGGGGATTGG - Intronic
1033689171 7:143721100-143721122 ACTTTCAAGAAGATGGGGATTGG + Intronic
1033698047 7:143811408-143811430 ACTTTCAAGAAGATGGGGATTGG + Intergenic
1035012214 7:155729313-155729335 ACTTCCATGCTGATAGGGTTTGG - Intronic
1035107300 7:156452555-156452577 ACTTACATTCAGGTGGGGCAGGG + Intergenic
1036370723 8:8160962-8160984 ACCTTCTTGCAGGTGGGGCTGGG - Intergenic
1036706769 8:11052483-11052505 TCTGGCATGCAGATGGCGCGAGG + Intronic
1036880170 8:12504668-12504690 ACCTTCTTGCAGGTGGGGCTGGG + Intergenic
1038643273 8:29343907-29343929 ACTTGCATGGATTTGGGGATGGG - Intronic
1039392944 8:37196497-37196519 GCTTGCAGGCTGATTGGGCTAGG - Intergenic
1042285908 8:67110024-67110046 ACTTGCATGGGGATGGGGCGGGG - Intronic
1042767962 8:72347102-72347124 AATTGCAAAAAGATGGGGCTGGG - Intergenic
1044435663 8:92159727-92159749 AATTGCATGTAGCTGGGGTTTGG - Intergenic
1044728678 8:95213346-95213368 ATTTGCATGCGGAAGGGGTTGGG + Intergenic
1045172072 8:99682627-99682649 AGCTGCCTGGAGATGGGGCTAGG + Intronic
1046546004 8:115650922-115650944 GCTTGCATGCTGAGGGGGCAAGG - Intronic
1047336205 8:123939117-123939139 ACTTGCTGGAAGATGGGGCTTGG + Intronic
1047513543 8:125533896-125533918 CCGTGCATGCTGACGGGGCTGGG + Intergenic
1049753261 8:144295886-144295908 ACCTGCATTCGGATGGCGCTGGG + Intronic
1051236137 9:15001176-15001198 AGTAGAATGCACATGGGGCTAGG + Intergenic
1055977844 9:81971987-81972009 ACTTGCATGCAGATGGGGCTTGG - Intergenic
1056350567 9:85744635-85744657 ACATGCAAGCTGATGGGGCCAGG + Intergenic
1058901896 9:109449285-109449307 AACTTCATGCAGATGGAGCTTGG - Intronic
1061209105 9:129180588-129180610 ACTAGCATGCAGAGGGATCTGGG + Intergenic
1062549277 9:137078438-137078460 CCCTGCAGGCAGACGGGGCTCGG - Intronic
1203572766 Un_KI270744v1:147374-147396 ACTTGTAGGCAGATGCAGCTGGG + Intergenic
1186492069 X:9981760-9981782 ACATGCATCCAGAAGGGGGTTGG - Intergenic
1188524093 X:31071130-31071152 AGCTGCATGCAGATGGGGCAGGG + Intergenic
1188770495 X:34147841-34147863 AGCTGCATGCAGATGGGGCAGGG - Intergenic
1189035828 X:37492808-37492830 AGCTGCATGCAGATGGGGCAGGG - Intronic
1189037309 X:37506120-37506142 AGCTGCATGCAGATGGGGCAGGG - Intronic
1192052076 X:67733473-67733495 AGTTGCATGAAGATGGGGCTGGG + Intergenic
1196761402 X:119203787-119203809 ACTTACATGAATATTGGGCTTGG + Intergenic
1197250025 X:124205857-124205879 ACTTGCATGTAGGTTTGGCTTGG + Intronic
1200935671 Y:8736165-8736187 ATTTGGATGCTGATGGGTCTTGG + Intergenic