ID: 1055978080

View in Genome Browser
Species Human (GRCh38)
Location 9:81973785-81973807
Sequence CAAGATCACCTTCTCCAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055978080_1055978087 18 Left 1055978080 9:81973785-81973807 CCTATTTGGAGAAGGTGATCTTG No data
Right 1055978087 9:81973826-81973848 TGCTACTACATCTTACACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055978080 Original CRISPR CAAGATCACCTTCTCCAAAT AGG (reversed) Intergenic
No off target data available for this crispr