ID: 1055978509

View in Genome Browser
Species Human (GRCh38)
Location 9:81977162-81977184
Sequence AGGGCTCTGAGCGGTTTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055978509_1055978523 23 Left 1055978509 9:81977162-81977184 CCTCGGAAACCGCTCAGAGCCCT No data
Right 1055978523 9:81977208-81977230 GGATACTCGATGGAACTCGAGGG No data
1055978509_1055978518 2 Left 1055978509 9:81977162-81977184 CCTCGGAAACCGCTCAGAGCCCT No data
Right 1055978518 9:81977187-81977209 GCGCGGGGCTGCACCTGCCAAGG No data
1055978509_1055978519 13 Left 1055978509 9:81977162-81977184 CCTCGGAAACCGCTCAGAGCCCT No data
Right 1055978519 9:81977198-81977220 CACCTGCCAAGGATACTCGATGG No data
1055978509_1055978522 22 Left 1055978509 9:81977162-81977184 CCTCGGAAACCGCTCAGAGCCCT No data
Right 1055978522 9:81977207-81977229 AGGATACTCGATGGAACTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055978509 Original CRISPR AGGGCTCTGAGCGGTTTCCG AGG (reversed) Intergenic
No off target data available for this crispr