ID: 1055979052

View in Genome Browser
Species Human (GRCh38)
Location 9:81983643-81983665
Sequence AGACTTCTGGGTGACGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055979047_1055979052 3 Left 1055979047 9:81983617-81983639 CCAAGTGCAATGTGAAATCTAAG No data
Right 1055979052 9:81983643-81983665 AGACTTCTGGGTGACGGTGTAGG No data
1055979046_1055979052 20 Left 1055979046 9:81983600-81983622 CCTTGGAGATAATAAAACCAAGT No data
Right 1055979052 9:81983643-81983665 AGACTTCTGGGTGACGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055979052 Original CRISPR AGACTTCTGGGTGACGGTGT AGG Intergenic
No off target data available for this crispr