ID: 1055979067

View in Genome Browser
Species Human (GRCh38)
Location 9:81983733-81983755
Sequence CATTTTAAGCAGCCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055979067_1055979073 9 Left 1055979067 9:81983733-81983755 CCTCCCACAGGCTGCTTAAAATG No data
Right 1055979073 9:81983765-81983787 GAGCTTATTACAAGGCTTGGTGG No data
1055979067_1055979071 1 Left 1055979067 9:81983733-81983755 CCTCCCACAGGCTGCTTAAAATG No data
Right 1055979071 9:81983757-81983779 TTTGGTAAGAGCTTATTACAAGG No data
1055979067_1055979072 6 Left 1055979067 9:81983733-81983755 CCTCCCACAGGCTGCTTAAAATG No data
Right 1055979072 9:81983762-81983784 TAAGAGCTTATTACAAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055979067 Original CRISPR CATTTTAAGCAGCCTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr