ID: 1055980239

View in Genome Browser
Species Human (GRCh38)
Location 9:81993707-81993729
Sequence GTCTGCCATCCTCTGTTGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055980239 Original CRISPR GTCTGCCATCCTCTGTTGTC CGG (reversed) Exonic
900555192 1:3276798-3276820 GTCTGACATCTCCTGTTGCCTGG + Intronic
900584280 1:3424951-3424973 GTCTCCTGCCCTCTGTTGTCTGG - Intronic
900802426 1:4745634-4745656 ATCTCCCATCCTCTGTGCTCTGG - Intronic
901770306 1:11526832-11526854 GTCTGCCAGGCTCTGTTACCGGG - Exonic
904793681 1:33042950-33042972 TTCTTCCATTCTCTGTAGTCTGG - Intronic
906066743 1:42986250-42986272 GTGTGCCCTCCCCTGTTGCCTGG + Intergenic
906150197 1:43583205-43583227 GCCTGCCAGTCTCTGTTGTTTGG + Intronic
906371994 1:45261984-45262006 GTATGGCATCCACTGTTCTCAGG - Intronic
908454576 1:64290584-64290606 GTCTGCCATCCCCCTTAGTCTGG - Intergenic
912750185 1:112281019-112281041 GTCTTCCATTCTGTGTTGTGTGG - Intergenic
914833633 1:151189741-151189763 TTCTGCCGTTCTCTGTTCTCTGG + Intronic
917768502 1:178249987-178250009 GTCTGTCAACCCCTGTTGTGAGG + Intronic
918344852 1:183598075-183598097 GTCTGGCTTCCTCTGCTTTCCGG - Intronic
919247443 1:195006353-195006375 TTCTGCCATATTCTGTTGTAAGG + Intergenic
919729751 1:200905783-200905805 GTTTGCTAACCTCTGTTGTAAGG + Intronic
919940436 1:202282406-202282428 GCCTGCTGTCCTCTTTTGTCTGG + Intronic
920398027 1:205660588-205660610 GTCTGCCATCAGCTGCTGTTAGG + Intronic
921090874 1:211841088-211841110 AGCTACCATCCTCTCTTGTCTGG - Intergenic
921138232 1:212282253-212282275 GAATGCCATCCTCTCTTTTCAGG + Intergenic
922666614 1:227474609-227474631 GTCTGTCATCCTCTGCTGGGAGG - Intergenic
923177737 1:231484056-231484078 GTCTGCCTTTCTCTGTTTCCTGG - Intergenic
923991073 1:239437442-239437464 TTCTGCCACTCTCTGTTCTCTGG + Intronic
924367325 1:243309093-243309115 GCCTGGCATCTTCTGTTGTTTGG + Intronic
924925927 1:248680519-248680541 GTCTGCCATTCTCAGGTGACTGG - Intergenic
1062948699 10:1479430-1479452 ATCTCCCAGCCTCTGCTGTCCGG - Intronic
1064269117 10:13849297-13849319 GTCTGCCATCTGCTCCTGTCTGG - Intronic
1066799188 10:39165399-39165421 CTCTGCCAGCCTTTGGTGTCAGG - Intergenic
1066806676 10:39262927-39262949 CTCTGCCATCCTTTGGTATCAGG - Intergenic
1069845074 10:71365369-71365391 GTCTCTCATGCTCTGTTGTAGGG + Intergenic
1070152924 10:73816245-73816267 GTCTGCCTTCCTCCATAGTCAGG + Intronic
1071494255 10:86156916-86156938 GCCTGTCATCCTCTCTTGCCTGG - Intronic
1075887340 10:125912660-125912682 GTCTTGCTTGCTCTGTTGTCCGG + Intronic
1076075789 10:127532857-127532879 GTCTGCCCTCCTCTCTTCCCCGG - Intergenic
1077162856 11:1121538-1121560 GGCTGCCATCCTCTGTGCACTGG - Intergenic
1080017814 11:27525949-27525971 GCCTGCCATCCTGTGTTTGCTGG - Intergenic
1083847450 11:65344277-65344299 TTCTGCCATCCTCTGGGGTAGGG + Intronic
1086456547 11:86964557-86964579 GTCTGCCAGGCTTTGGTGTCAGG + Intergenic
1087138062 11:94740280-94740302 GTCTGCCCTCCTCTGATGCTTGG - Intronic
1088364017 11:109019977-109019999 GTCTGCGACCATCTGTGGTCTGG - Intergenic
1088498331 11:110455586-110455608 TTCTGCACGCCTCTGTTGTCAGG + Intronic
1088749993 11:112835290-112835312 GTCTCACATCCTTTGTTGCCTGG + Intergenic
1089507650 11:118974730-118974752 ATCTACCATCATCTCTTGTCTGG - Intronic
1089966270 11:122656622-122656644 GTCTGGGATCCTCCGGTGTCTGG + Intronic
1093220901 12:16419316-16419338 GTCTGGCATATTCTCTTGTCTGG + Intronic
1093288335 12:17294136-17294158 ATTTGCCATCATCTTTTGTCTGG + Intergenic
1093383282 12:18521190-18521212 GTCTGACAACCTCTGTTGGAGGG + Intronic
1094779702 12:33776519-33776541 CTCTGCCAGCCTTTGGTGTCAGG - Intergenic
1099406535 12:82270446-82270468 GTAGGCAATCCTCTGTTTTCTGG - Intronic
1099421818 12:82471264-82471286 GTCTGCATTCCTGTGTGGTCAGG + Intronic
1101191558 12:102338730-102338752 AGCTGTCATCATCTGTTGTCTGG + Intergenic
1103562346 12:121799420-121799442 GTGAGCCGTCCTCTGATGTCTGG - Intronic
1103562388 12:121799644-121799666 GTCTGTCAGCTTCTGTTGTCAGG - Intronic
1104313400 12:127675228-127675250 GACTGCCTCCCTCTCTTGTCTGG - Intergenic
1104436386 12:128760245-128760267 TTTTGCCATACCCTGTTGTCTGG - Intergenic
1104542626 12:129681453-129681475 GTCTTCCAGCCTCTCCTGTCAGG - Intronic
1106877035 13:34085431-34085453 GTCTTCCATCCCCTTCTGTCTGG - Intergenic
1107314739 13:39119391-39119413 GTCTGGCAACCTCTGTTGGGAGG + Intergenic
1110060438 13:71032918-71032940 GCCTGACCTCCCCTGTTGTCAGG - Intergenic
1111438126 13:88239452-88239474 GTCTCCCATTCTCTGCTGTGGGG + Intergenic
1112252686 13:97797847-97797869 GACTGCCAACCTCTGTTCCCAGG + Intergenic
1113159759 13:107366740-107366762 GTCCGACATCCCATGTTGTCAGG + Intronic
1114146728 14:19985815-19985837 GTAGTCTATCCTCTGTTGTCAGG - Intergenic
1115502124 14:34059620-34059642 GTCTCCCATTCTGTGTTCTCTGG - Intronic
1116850821 14:49907191-49907213 GTCTCCCATCCCGTGTTGTTAGG + Intergenic
1118466704 14:66037913-66037935 AGCTGCCATCCTGTATTGTCGGG + Intergenic
1120178660 14:81321402-81321424 CTCTACCATCCTGTGTTTTCTGG - Intronic
1121176678 14:91895827-91895849 GACTGCCAGCTTCTGTTGGCAGG - Intronic
1125474970 15:40040923-40040945 GTTTGCAATCCCCTGTTGTGTGG + Intergenic
1126345337 15:47687698-47687720 GGCTGTCAGCCTCTGTTGCCGGG - Intronic
1129077192 15:73007399-73007421 CTCTGCCATTGTCTGTGGTCTGG + Intergenic
1131690776 15:94824964-94824986 GTTTGCCATTCTCTGTTTTCAGG + Intergenic
1132215486 15:100058722-100058744 GCCTGCCATCCTCTGATCACCGG + Intronic
1138039077 16:53642783-53642805 GACTGGCAGCCTCTGTTGTAGGG + Intronic
1138434571 16:56989849-56989871 ATCTGCCATCCTCTGCGGGCCGG - Intronic
1139373472 16:66482177-66482199 GGCTGCCACCCTCTGTGGGCTGG - Intronic
1141171711 16:81695882-81695904 CTCTGCCACCCTCTCTTGTTAGG - Intronic
1141633868 16:85303546-85303568 ACCTGCCACCCTCAGTTGTCGGG - Intergenic
1141750372 16:85954421-85954443 GTCTGCCCGCCTCTGTAGTAAGG + Intergenic
1142911646 17:3098223-3098245 GTCTGACATCCCCTGTTGGAGGG - Intergenic
1144634999 17:16900456-16900478 GTCTGCCCTTGTGTGTTGTCAGG + Intergenic
1147316747 17:39624655-39624677 TTCTGCCTTTCTCTGTTGTGAGG + Intergenic
1152041693 17:77907748-77907770 GTCTCCCATCCTCAGCTGGCTGG - Intergenic
1153306972 18:3640311-3640333 GTGTGCCATTCTCTGTTGCTTGG - Intronic
1153451377 18:5233291-5233313 ATCAGCCATCCTCAGTTGCCTGG - Intergenic
1154463850 18:14623387-14623409 GTAGTCTATCCTCTGTTGTCAGG - Intergenic
1155259963 18:24032083-24032105 CTCTTCCATCCTCTGGTGACTGG - Intronic
1156154249 18:34282799-34282821 GACTGCCATCTTCTCTTTTCGGG + Intergenic
1156860439 18:41829767-41829789 GTCAGCCATCATCTATTCTCAGG + Intergenic
1157022238 18:43798676-43798698 GTCTGCCATCCTTGGTTCTCTGG + Intergenic
1157746761 18:50142637-50142659 GTCTGCCTTGCTCTGTAGTGTGG + Intronic
1158533944 18:58290949-58290971 GCCTGCCAACCTATGTTGACGGG - Intronic
1159076723 18:63688755-63688777 GTCTGCCAACCCCTGTTGGGAGG - Intronic
1159077851 18:63701675-63701697 GTCTGCCATCATTGGTTGGCAGG + Intronic
1160683861 19:424568-424590 GTCTGGCTTCCCCTGTTGACTGG + Intronic
1161156021 19:2732286-2732308 GTCTACCCTACTCTGTTGCCAGG - Intronic
1161317741 19:3626115-3626137 GACTGCCATCATCTACTGTCTGG + Intronic
1161404813 19:4085494-4085516 GTCTGTCTCCCTCTGTTGCCAGG + Intergenic
1161612876 19:5252948-5252970 GTTTGCCACCCTCTGATGCCAGG - Intronic
1161802137 19:6422165-6422187 GTCTGCCATCCTGAGGTATCAGG - Intronic
1163029958 19:14537443-14537465 GTCAACCCTCCTCTGTTCTCAGG - Intronic
1164723152 19:30446395-30446417 GTCGGCCATCATCTGGTCTCTGG + Intronic
1164814401 19:31183702-31183724 GTCAGCCACCCTCTGCTGTAGGG + Intergenic
1165758550 19:38307899-38307921 GTCTGCCATCCTCTCTGGATGGG - Intronic
1166723062 19:45008684-45008706 ATCTGTCCTCCTCTGTTCTCAGG - Intronic
1166906768 19:46115968-46115990 GGCTGCCACTCTCTGTTCTCAGG + Intergenic
925975442 2:9138896-9138918 GTGTGCCATGCTCTGTTCCCAGG - Intergenic
926242876 2:11101588-11101610 GGCTGCTATCATCTGTGGTCTGG - Intergenic
928846276 2:35676904-35676926 GCATGCCACCCTCTGCTGTCAGG + Intergenic
929034224 2:37675099-37675121 GTGGGCCAGGCTCTGTTGTCGGG - Intronic
929115725 2:38442296-38442318 GCCAGGCATCCTCTGTTCTCCGG + Intergenic
929877820 2:45811503-45811525 GTCAGCCTCCCTCTTTTGTCTGG - Intronic
930187790 2:48427560-48427582 CACTGCCATCATCTCTTGTCTGG - Intergenic
932174851 2:69590377-69590399 GTGTGCTCTCCTCTGTTCTCAGG - Intronic
932417476 2:71582280-71582302 GTCTGTCAACCTCTGTTCTAGGG + Intronic
933823620 2:86138569-86138591 GTCTGCCATCCTCTGAAGGCCGG + Exonic
935192706 2:100791757-100791779 GGAGGCCACCCTCTGTTGTCTGG - Intergenic
938124466 2:128662036-128662058 GCCTGCTCTCCTCTGGTGTCTGG + Intergenic
939948011 2:148433826-148433848 GTCTGCCAGCTTTTGTTGTCAGG + Intronic
940685588 2:156846493-156846515 CTTTGCCATTCTCTGTTTTCAGG - Intergenic
944201122 2:197108492-197108514 GTCTCTTATCCTCTGTGGTCAGG - Intronic
944855616 2:203764336-203764358 CTTTGCCATCCACTGTTGGCAGG + Intergenic
1169196763 20:3687413-3687435 GTCTGCCCTCCACTCTTGTAAGG + Exonic
1175207942 20:57326414-57326436 GTATGCTATCCTCTCCTGTCTGG + Intergenic
1176810681 21:13534986-13535008 GTAGTCTATCCTCTGTTGTCAGG + Intergenic
1176934678 21:14852890-14852912 GTCTGTCACCCTCTGGTTTCTGG - Intergenic
1178102964 21:29290082-29290104 GTCATGCATCCTCTGTTGTATGG - Intronic
1179205940 21:39278548-39278570 GTCTGCCTTTCTCTGATTTCTGG - Intronic
1179445844 21:41429663-41429685 ATCTGCCCACCTCTTTTGTCAGG - Intronic
1179999013 21:44986796-44986818 GTCAGCCAACCTCTGTGGCCTGG + Intergenic
1182495097 22:30701173-30701195 GTGTGCCATCTTCTGTTACCTGG - Intronic
1183602787 22:38849845-38849867 TTCTGCCCTCCTCTCTGGTCTGG - Intergenic
949844282 3:8354158-8354180 GTCTGCCTGGCTCTGATGTCTGG + Intergenic
950381393 3:12618580-12618602 GTTTGCCATCATCTGATGCCCGG + Exonic
951137317 3:19118631-19118653 GTCTGACAACCCCTGTTGTGGGG - Intergenic
952306994 3:32155390-32155412 GCCTCCCCTCCTCTGTTGACAGG + Intronic
954536778 3:51365963-51365985 CTCTGCCAGCCTTTGTTATCAGG + Intronic
959581929 3:107991360-107991382 TTCTGCCACCCTCTGTGGCCTGG - Intergenic
960413804 3:117359404-117359426 GTCTGACAACCTCTGTTGGACGG - Intergenic
962312162 3:134334371-134334393 GAGTGCCATCCTGTGTTCTCTGG + Intergenic
962739117 3:138349702-138349724 GTCAGCCACCCTCTCTGGTCAGG - Intronic
964047885 3:152353240-152353262 CTCTGCCTTCCTCTGATGTGTGG + Intronic
964382305 3:156109947-156109969 GTGTGCCATCCTCAGTCCTCAGG + Intronic
966387945 3:179421698-179421720 GTCTGCCATCCAGTGTTTGCTGG - Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
968746410 4:2362786-2362808 CTCTGCCCTCCTCTGGGGTCAGG + Intronic
970326659 4:14932260-14932282 CTCTGCCATGCTCTGTTATTAGG - Intergenic
970708803 4:18837612-18837634 GTCTAACATCCTCTGTTCCCTGG - Intergenic
971285969 4:25290549-25290571 GTCTGGCAACCTCTGTTGGGAGG + Intergenic
972063769 4:34912772-34912794 GTCTGCCAGCCTCTTGTATCTGG - Intergenic
973640457 4:52897631-52897653 GTCTGCCAGGCTTTGGTGTCAGG + Intronic
973670827 4:53216122-53216144 CTCTGCCAGCCTTTGGTGTCAGG + Intronic
974181149 4:58386330-58386352 GTCTGACAACCTCTGTTGGAGGG + Intergenic
974768729 4:66383228-66383250 GTCTGACAACCTCTGTTGGAGGG - Intergenic
976769411 4:88634705-88634727 GTCTGACAACCCCTGTTGGCGGG - Intronic
978541754 4:109823561-109823583 ATCTGCCACCCTTTGTTGTTAGG + Intronic
978600335 4:110420465-110420487 CTCTGCCAGCCTTTGTTATCAGG - Intronic
980200662 4:129652218-129652240 GTCTGTCAACCTCTGTTGGGAGG - Intergenic
980787340 4:137572532-137572554 GTCTGACAACCTCTGTTGGAGGG + Intergenic
983331316 4:166333152-166333174 GTCTGTCAACCTCTGTTGGGAGG + Intergenic
983682116 4:170365239-170365261 GTCTGCAATTCTCTGTTCCCAGG + Intergenic
985559771 5:578785-578807 TTCTCCCTTCCTTTGTTGTCCGG - Intergenic
992848805 5:80782816-80782838 GTATTCAATCCTCTGATGTCAGG - Intronic
993669930 5:90747805-90747827 GTCGGCTATCCGCTGGTGTCTGG - Intronic
996342309 5:122452184-122452206 CTCTGCCATCCCCTGTGGACTGG - Intronic
996829719 5:127726951-127726973 GTCTGGCAACCACTGTTGTAGGG - Intergenic
998012933 5:138709658-138709680 GTCTCCCTTCCTCTGCTGCCCGG + Intronic
1000553302 5:162693241-162693263 GTCTGCCAGGCTTTGTTATCAGG + Intergenic
1001046372 5:168375238-168375260 TCTTGCCACCCTCTGTTGTCTGG - Intronic
1001207929 5:169781486-169781508 GTCAGCCAGTCTCTGTTGCCAGG + Intronic
1002025378 5:176393066-176393088 GGCTGCCCTCCTCTGAAGTCAGG - Intronic
1003405422 6:5823716-5823738 GTCTGCCAGTCTCTATTGGCAGG + Intergenic
1004637177 6:17480175-17480197 GACTGTCATCCTCTGTAGTCTGG - Intronic
1009494301 6:64329435-64329457 GTCTCCATTCCTCTGTTGTTGGG - Intronic
1010024330 6:71198207-71198229 GTCAGCCATCCACTTTTGCCTGG + Intergenic
1010209063 6:73348695-73348717 GTCTCCCAACCTCTGTAGACAGG - Intergenic
1011377584 6:86706562-86706584 GTCTGGCATACCCTGTTGTGAGG + Intergenic
1013389257 6:109666681-109666703 GTCTGCCATCTTCATTTGTATGG - Intronic
1018141713 6:160844314-160844336 GTTTGCCATCGTCTTTTCTCTGG + Intergenic
1020513578 7:9089802-9089824 GTCTGCAGGCCTCTGTTGTGAGG - Intergenic
1021883158 7:25113221-25113243 TTCTGCCATCCTCAGGTGTGTGG + Intergenic
1029039562 7:97558223-97558245 GTCTGACAGCCTCTGTTGGAGGG - Intergenic
1029062610 7:97813998-97814020 GTCTGCCATGCTTTGGTATCAGG - Intergenic
1029606340 7:101601559-101601581 CTCTGCCATCCTTTGTTTCCTGG - Intergenic
1030426385 7:109384171-109384193 CTCTGCCAGCCTCTGGTATCAGG - Intergenic
1031864941 7:127028309-127028331 CTCTGCCAGGCTTTGTTGTCAGG + Intronic
1031923642 7:127619183-127619205 GTCTTCCATTCTCTGATTTCTGG - Intergenic
1032106740 7:129037961-129037983 GTCTGCCATTCTCTCTGGTAGGG - Intronic
1033002240 7:137519250-137519272 GGCTGCCATCCATTATTGTCAGG + Intronic
1033012360 7:137636082-137636104 TTCTTCCAGCTTCTGTTGTCAGG - Intronic
1035112374 7:156493872-156493894 GGTTGCCATCCACTGTGGTCAGG - Intergenic
1036490239 8:9218375-9218397 GGCTGCCATCATCTCTTGTCTGG - Intergenic
1036674307 8:10817323-10817345 GGCTCCCATCCTCAGTTGGCGGG - Intronic
1039145503 8:34442020-34442042 GTCTGCCAGCCTTTGGTATCAGG - Intergenic
1040712560 8:50207042-50207064 CTCTGCCAGCCTTTGTTATCAGG + Intronic
1040736087 8:50510391-50510413 CTCTGCCAGCCTTTGTTATCAGG + Intronic
1040841891 8:51793037-51793059 GTCTGGCAACCCCTGTTGTGGGG - Intronic
1041471901 8:58219966-58219988 GTCTGCCAGCCTGTGCTGTCCGG + Intergenic
1043277037 8:78411102-78411124 GTCTGCCATCTGCTTTTGTGTGG - Intergenic
1044512523 8:93098785-93098807 GCCTGCCATTCTTTGTTGTTTGG - Intergenic
1047849629 8:128842540-128842562 CTCTGCCATCCTCTGTCCTGAGG - Intergenic
1052369313 9:27645870-27645892 GTCTGCCAACCTCTGTTGGAGGG - Intergenic
1052387085 9:27835306-27835328 GTCTGGCAACCTCTGTTGGGGGG + Intergenic
1052888311 9:33670995-33671017 GTCTGCCATGCTTTGGTATCAGG - Intergenic
1055797823 9:79994517-79994539 ATCTGCCATCCTTTTTTGCCTGG + Intergenic
1055977685 9:81970612-81970634 ATCTGCCATTCTCAATTGTCTGG - Intergenic
1055980239 9:81993707-81993729 GTCTGCCATCCTCTGTTGTCCGG - Exonic
1056444990 9:86656832-86656854 ATCTCCCATCCTGTGTTCTCTGG + Intergenic
1058700168 9:107593606-107593628 ATCTGCCTGCCTCTGTTTTCTGG + Intergenic
1059535128 9:115073639-115073661 GTCTGCCTTTCTCGGCTGTCAGG + Exonic
1059596364 9:115724533-115724555 GTCTGACATCCCCTGTTGGAGGG - Intergenic
1059685315 9:116629481-116629503 CTCTGCCCTACTGTGTTGTCTGG - Intronic
1060016411 9:120090206-120090228 GTCTGTCATCATCTTTCGTCTGG - Intergenic
1061298470 9:129690180-129690202 CGCTGCGATCCTCTGTTTTCAGG + Intronic
1061506206 9:131033307-131033329 GTCTGCCATCCCCAGGTGACTGG - Intronic
1185695507 X:2191351-2191373 GTATGCCATTCTCTGTTGTTTGG - Intergenic
1186939149 X:14485717-14485739 ATCTGCCATCTTCTGTCATCTGG + Intergenic
1187427148 X:19188283-19188305 ATCTGCCATCCTCTGATGATGGG - Intergenic
1189199182 X:39177103-39177125 GTCTACCAAACTCTGTTGGCTGG + Intergenic
1189250006 X:39593431-39593453 CTCCACCATCCTCTGTGGTCTGG - Intergenic
1190007858 X:46757897-46757919 GTCAGCCATCTTTTGTTGTTAGG - Intronic
1191684174 X:63871699-63871721 GGCTGCCTTCCTCTGTTGGATGG - Intergenic
1193074159 X:77337617-77337639 CTCTGCCAGCCTTTGTTATCAGG - Intergenic
1195162933 X:102188657-102188679 CTCTGCCAGGCTTTGTTGTCAGG + Intergenic
1200056210 X:153462711-153462733 GTCTGCTGTCCCCTGCTGTCTGG - Intronic
1200864556 Y:8029044-8029066 GTCTGCCAGGCTTTGTTATCAGG + Intergenic
1201186174 Y:11405175-11405197 CTCTGCCAGGCTCTGTTATCAGG + Intergenic
1201377894 Y:13342022-13342044 GTCTCCATTCCTCTGTTGTGGGG - Intronic
1201493944 Y:14573072-14573094 CTCTGCCAGGCTTTGTTGTCAGG + Intronic
1201559419 Y:15300384-15300406 GTCTGCCATCCCCAGAGGTCAGG - Intergenic
1201896400 Y:18997191-18997213 GTCTCCATTCCTCTGTTGTGGGG - Intergenic